ID: 986096500

View in Genome Browser
Species Human (GRCh38)
Location 5:4559673-4559695
Sequence ATGAACAGGCTTAGTTTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986096495_986096500 30 Left 986096495 5:4559620-4559642 CCATCTACAAGGAAAGAAAAATT No data
Right 986096500 5:4559673-4559695 ATGAACAGGCTTAGTTTGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986096500 Original CRISPR ATGAACAGGCTTAGTTTGTT GGG Intergenic
No off target data available for this crispr