ID: 986111227

View in Genome Browser
Species Human (GRCh38)
Location 5:4720646-4720668
Sequence GGGTGAGACCAAAAGGAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986111227_986111233 12 Left 986111227 5:4720646-4720668 CCTGCTTCCTTTTGGTCTCACCC No data
Right 986111233 5:4720681-4720703 TTGGATGTACCTGAATGCCAAGG No data
986111227_986111230 -7 Left 986111227 5:4720646-4720668 CCTGCTTCCTTTTGGTCTCACCC No data
Right 986111230 5:4720662-4720684 CTCACCCTGTCTTTTGGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986111227 Original CRISPR GGGTGAGACCAAAAGGAAGC AGG (reversed) Intergenic
No off target data available for this crispr