ID: 986111227 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:4720646-4720668 |
| Sequence | GGGTGAGACCAAAAGGAAGC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986111227_986111233 | 12 | Left | 986111227 | 5:4720646-4720668 | CCTGCTTCCTTTTGGTCTCACCC | No data | ||
| Right | 986111233 | 5:4720681-4720703 | TTGGATGTACCTGAATGCCAAGG | No data | ||||
| 986111227_986111230 | -7 | Left | 986111227 | 5:4720646-4720668 | CCTGCTTCCTTTTGGTCTCACCC | No data | ||
| Right | 986111230 | 5:4720662-4720684 | CTCACCCTGTCTTTTGGCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986111227 | Original CRISPR | GGGTGAGACCAAAAGGAAGC AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||