ID: 986113878 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:4750335-4750357 |
| Sequence | CATGAAAGCAGCTGGGAGGG AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 3167 | |||
| Summary | {0: 149, 1: 263, 2: 597, 3: 852, 4: 1306} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 986113878_986113887 | 23 | Left | 986113878 | 5:4750335-4750357 | CCTCCCTCCCAGCTGCTTTCATG | 0: 149 1: 263 2: 597 3: 852 4: 1306 |
||
| Right | 986113887 | 5:4750381-4750403 | TTTTCCAAGCACATGGTGCAAGG | No data | ||||
| 986113878_986113886 | 16 | Left | 986113878 | 5:4750335-4750357 | CCTCCCTCCCAGCTGCTTTCATG | 0: 149 1: 263 2: 597 3: 852 4: 1306 |
||
| Right | 986113886 | 5:4750374-4750396 | CTACAGCTTTTCCAAGCACATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 986113878 | Original CRISPR | CATGAAAGCAGCTGGGAGGG AGG (reversed) | Intergenic | ||
| Too many off-targets to display for this crispr | |||||