ID: 986113878

View in Genome Browser
Species Human (GRCh38)
Location 5:4750335-4750357
Sequence CATGAAAGCAGCTGGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3167
Summary {0: 149, 1: 263, 2: 597, 3: 852, 4: 1306}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986113878_986113887 23 Left 986113878 5:4750335-4750357 CCTCCCTCCCAGCTGCTTTCATG 0: 149
1: 263
2: 597
3: 852
4: 1306
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113878_986113886 16 Left 986113878 5:4750335-4750357 CCTCCCTCCCAGCTGCTTTCATG 0: 149
1: 263
2: 597
3: 852
4: 1306
Right 986113886 5:4750374-4750396 CTACAGCTTTTCCAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986113878 Original CRISPR CATGAAAGCAGCTGGGAGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr