ID: 986113880

View in Genome Browser
Species Human (GRCh38)
Location 5:4750338-4750360
Sequence GGCCATGAAAGCAGCTGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986113880_986113887 20 Left 986113880 5:4750338-4750360 CCCTCCCAGCTGCTTTCATGGCC No data
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113880_986113889 29 Left 986113880 5:4750338-4750360 CCCTCCCAGCTGCTTTCATGGCC No data
Right 986113889 5:4750390-4750412 CACATGGTGCAAGGTGTCAGTGG No data
986113880_986113886 13 Left 986113880 5:4750338-4750360 CCCTCCCAGCTGCTTTCATGGCC No data
Right 986113886 5:4750374-4750396 CTACAGCTTTTCCAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986113880 Original CRISPR GGCCATGAAAGCAGCTGGGA GGG (reversed) Intergenic
No off target data available for this crispr