ID: 986113881

View in Genome Browser
Species Human (GRCh38)
Location 5:4750339-4750361
Sequence AGGCCATGAAAGCAGCTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2709
Summary {0: 4, 1: 175, 2: 315, 3: 852, 4: 1363}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986113881_986113887 19 Left 986113881 5:4750339-4750361 CCTCCCAGCTGCTTTCATGGCCT 0: 4
1: 175
2: 315
3: 852
4: 1363
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113881_986113889 28 Left 986113881 5:4750339-4750361 CCTCCCAGCTGCTTTCATGGCCT 0: 4
1: 175
2: 315
3: 852
4: 1363
Right 986113889 5:4750390-4750412 CACATGGTGCAAGGTGTCAGTGG No data
986113881_986113886 12 Left 986113881 5:4750339-4750361 CCTCCCAGCTGCTTTCATGGCCT 0: 4
1: 175
2: 315
3: 852
4: 1363
Right 986113886 5:4750374-4750396 CTACAGCTTTTCCAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986113881 Original CRISPR AGGCCATGAAAGCAGCTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr