ID: 986113883

View in Genome Browser
Species Human (GRCh38)
Location 5:4750342-4750364
Sequence ACCAGGCCATGAAAGCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2589
Summary {0: 3, 1: 86, 2: 383, 3: 853, 4: 1264}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986113883_986113887 16 Left 986113883 5:4750342-4750364 CCCAGCTGCTTTCATGGCCTGGT 0: 3
1: 86
2: 383
3: 853
4: 1264
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113883_986113886 9 Left 986113883 5:4750342-4750364 CCCAGCTGCTTTCATGGCCTGGT 0: 3
1: 86
2: 383
3: 853
4: 1264
Right 986113886 5:4750374-4750396 CTACAGCTTTTCCAAGCACATGG No data
986113883_986113889 25 Left 986113883 5:4750342-4750364 CCCAGCTGCTTTCATGGCCTGGT 0: 3
1: 86
2: 383
3: 853
4: 1264
Right 986113889 5:4750390-4750412 CACATGGTGCAAGGTGTCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986113883 Original CRISPR ACCAGGCCATGAAAGCAGCT GGG (reversed) Intergenic
Too many off-targets to display for this crispr