ID: 986113884

View in Genome Browser
Species Human (GRCh38)
Location 5:4750343-4750365
Sequence CACCAGGCCATGAAAGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1153
Summary {0: 3, 1: 71, 2: 143, 3: 331, 4: 605}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986113884_986113887 15 Left 986113884 5:4750343-4750365 CCAGCTGCTTTCATGGCCTGGTG 0: 3
1: 71
2: 143
3: 331
4: 605
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113884_986113889 24 Left 986113884 5:4750343-4750365 CCAGCTGCTTTCATGGCCTGGTG 0: 3
1: 71
2: 143
3: 331
4: 605
Right 986113889 5:4750390-4750412 CACATGGTGCAAGGTGTCAGTGG No data
986113884_986113886 8 Left 986113884 5:4750343-4750365 CCAGCTGCTTTCATGGCCTGGTG 0: 3
1: 71
2: 143
3: 331
4: 605
Right 986113886 5:4750374-4750396 CTACAGCTTTTCCAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986113884 Original CRISPR CACCAGGCCATGAAAGCAGC TGG (reversed) Intergenic
900492088 1:2955394-2955416 CGCCAACCCATGAAAGCAGCTGG - Intergenic
900822727 1:4901675-4901697 CACCAGCCTGTGAAAGCAGCCGG - Intergenic
900824932 1:4918815-4918837 TGCCAGCCCATGAAAGCAGCCGG - Intergenic
901063413 1:6484314-6484336 CACCAGCCCCTGGCAGCAGCTGG - Intronic
901168005 1:7233695-7233717 CTCGAGGCCATGGAAGCAACTGG - Intronic
902271299 1:15307015-15307037 CGCCAGCCCATGAAAGCAGCTGG + Intronic
902677669 1:18020119-18020141 CACGGGGCCATGCAAACAGCAGG + Intergenic
902983888 1:20143702-20143724 CACCAAGTCATCAAAGAAGCTGG - Intronic
903934303 1:26884388-26884410 CTCCAGGCCAAGAAAGCTACAGG - Intronic
904475698 1:30763463-30763485 AACCAGGCTAGGAAGGCAGCAGG - Intergenic
904571992 1:31473192-31473214 TGCTAGCCCATGAAAGCAGCTGG - Intergenic
906157956 1:43625223-43625245 CACCAGTCCTTGCGAGCAGCCGG + Intergenic
906369561 1:45241190-45241212 TGCCAGCCCATGAAAGCAGCTGG - Intronic
906760433 1:48372489-48372511 TGCCAGCCCGTGAAAGCAGCAGG - Intronic
906770103 1:48475918-48475940 TACCAGCCTGTGAAAGCAGCTGG + Intergenic
907392152 1:54165213-54165235 CTCCAGCTCTTGAAAGCAGCCGG - Intronic
908006964 1:59737403-59737425 CACCAGCCCATGAAAGCATCTGG + Intronic
908091073 1:60686114-60686136 CACCAGCCCATGAAGGAAGCTGG + Intergenic
908729252 1:67208893-67208915 TACCAGCCCATGAAAGCAGCTGG + Intronic
908871679 1:68620285-68620307 CGCCAGCCCATGAAAGCAGCTGG - Intergenic
908967799 1:69787247-69787269 TGACAGCCCATGAAAGCAGCTGG - Intronic
909063482 1:70905420-70905442 CACCAGCCCATGAAAGCAGCTGG + Intronic
909066264 1:70939312-70939334 CACTAGCTCATGAAAGCAGCTGG - Intronic
909086171 1:71172312-71172334 CACCAGCCTGTGAAATCAGCTGG - Intergenic
909129298 1:71714791-71714813 TGCCAGGCTGTGAAAGCAGCTGG - Intronic
909235888 1:73152434-73152456 TACCAGCCCATCAAAGCAGCTGG - Intergenic
909265223 1:73549823-73549845 TGCCAGCCCATGAAAGCAGATGG - Intergenic
909269138 1:73600714-73600736 TGTCAGCCCATGAAAGCAGCTGG - Intergenic
909416915 1:75416637-75416659 CACCAGCCCATGAAAGCAGCCGG + Intronic
909632884 1:77785782-77785804 TGCCAGCCCATAAAAGCAGCCGG - Intronic
910233169 1:85007774-85007796 CGCCAGCCTGTGAAAGCAGCTGG - Intronic
910327576 1:86027838-86027860 TGCCAGACCATGAAGGCAGCTGG + Intronic
910586791 1:88889661-88889683 CACTAGGCCATGAAACTGGCTGG - Intronic
911041220 1:93592436-93592458 CACCAGGCCATGCCAGCTGGAGG + Intronic
911309528 1:96275946-96275968 TGCCAGCCCATGAAAGCAGCCGG + Intergenic
911535028 1:99089698-99089720 CACCAGCCCATGAAAACAAATGG + Intergenic
911738532 1:101362869-101362891 TGCCAGCCCGTGAAAGCAGCTGG + Intergenic
911788345 1:101979853-101979875 TGCCAGCCCATGAAAGCAGCTGG + Intronic
911893490 1:103401498-103401520 CACCAGCCCATGAAAGAAGCTGG - Intergenic
911985434 1:104616533-104616555 CACCAGCCCTTGAAAGGAGCTGG - Intergenic
912165720 1:107040160-107040182 CACCAGCCCATGAAAGCAGGTGG + Intergenic
912263530 1:108132110-108132132 CACGAGCCCATGAAAGCAGCCGG - Intergenic
912279415 1:108297509-108297531 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
912288811 1:108396848-108396870 TGCCAGCCCATGAAAGCAGCTGG + Intronic
912327775 1:108785017-108785039 CACCAGCCCATGAAAGCAGCTGG - Intronic
912610180 1:111034633-111034655 CACCAGCCCATGAAGGCAGCAGG + Intergenic
912940696 1:114042234-114042256 CAGCAGGTGTTGAAAGCAGCAGG - Intergenic
913278023 1:117158074-117158096 TGCCAGCCTATGAAAGCAGCTGG - Intronic
913383956 1:118239475-118239497 CACTGGCCCATGAAAGCAGCTGG + Intergenic
913539528 1:119805505-119805527 ATCCAAGCCATGAAAGCAGAGGG + Intronic
914230570 1:145761844-145761866 CACCAGCCAGTGAAAGCAGCCGG + Intronic
915828359 1:159102541-159102563 CACCAACCCGTGAAAGCACCCGG + Intronic
916477434 1:165183601-165183623 CGCCAGCCCATGAAAGCAGCTGG + Intergenic
917892493 1:179453363-179453385 TGCCAGACCATGAAAGCAGCCGG + Intronic
918591356 1:186245033-186245055 CGCCAGCCGGTGAAAGCAGCGGG - Intergenic
918633562 1:186748035-186748057 CTCCAGCCCATGAAAACAGCTGG + Intergenic
918862046 1:189841383-189841405 CATCAGGTCATTTAAGCAGCTGG + Intergenic
919006927 1:191910020-191910042 GGTCAGCCCATGAAAGCAGCTGG - Intergenic
919011711 1:191973772-191973794 TGCCAGCCCATGAAAGCAACTGG - Intergenic
919129198 1:193432697-193432719 TGCCAGCCCATAAAAGCAGCTGG - Intergenic
919290526 1:195623993-195624015 CACCAGCTCGTGAAAGCAGCCGG + Intergenic
919398669 1:197081812-197081834 CCCCAGCCCATGAAAGCAGCTGG + Intergenic
919554251 1:199031376-199031398 CACCAGCACATGAAAGAAGCTGG - Intergenic
921643714 1:217587477-217587499 CACAGGGCCTTGAAACCAGCAGG + Intronic
922069162 1:222174250-222174272 CAACAGTCCATGAGAGCAGCTGG - Intergenic
922164140 1:223100915-223100937 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
922900826 1:229135208-229135230 CACCAGTCCATGAAAGCAGCAGG + Intergenic
923158643 1:231299360-231299382 CACCAGGCCAGTAAATCAACAGG - Intergenic
923297881 1:232612409-232612431 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
923378076 1:233386596-233386618 CAGCAGGCCATTTCAGCAGCTGG + Intergenic
923461254 1:234211421-234211443 TGCCAGCCCATGAAAGCAGCTGG + Intronic
923687426 1:236163017-236163039 CACCAGCCCGTGAAAGCAGCCGG + Intronic
923919291 1:238545840-238545862 TACCAGCCCATGGAAACAGCTGG - Intergenic
924040557 1:239980128-239980150 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
924394805 1:243607271-243607293 CACCAGCCCATGAAAGTAGCTGG + Intronic
924806641 1:247366724-247366746 CACCATCCTATGAAAGCAGCCGG + Intergenic
1062994788 10:1855762-1855784 CACCAGGGCCTGACAGCACCAGG + Intergenic
1063626186 10:7692095-7692117 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1064363094 10:14683411-14683433 CCACAGGCCAAGAAAGCCGCAGG + Intronic
1064562026 10:16602921-16602943 CACCAGCCCCTGATAGCCGCCGG - Intronic
1065405396 10:25357912-25357934 CAGCAGCCTGTGAAAGCAGCTGG + Intronic
1066098767 10:32098291-32098313 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1066224228 10:33366725-33366747 CTCCAGGCTATGAAACCAGTGGG + Intergenic
1066636870 10:37511820-37511842 CACCAGCCAATGAAGGCAGCTGG + Intergenic
1067428734 10:46228208-46228230 CCCCAGGCCAGGAAGGGAGCAGG + Intergenic
1067666057 10:48280207-48280229 CACCAGCCCGTGAAGGCAGCTGG - Intergenic
1067812253 10:49439002-49439024 TGGCAGCCCATGAAAGCAGCTGG - Intergenic
1067911504 10:50351008-50351030 TGCCAGTCCATGAAATCAGCCGG + Intronic
1068264313 10:54626845-54626867 TACCAGCCCATGAAAGCAGCTGG + Intronic
1069040852 10:63694155-63694177 TGCCAACCCATGAAAGCAGCCGG + Intergenic
1069077316 10:64051953-64051975 TGCCAGCCCATGAAAGCAGCAGG - Intergenic
1070565164 10:77598471-77598493 CACTTGGCCAGGAAAGCTGCAGG + Intronic
1070779229 10:79127813-79127835 CCCCAGCCAATTAAAGCAGCTGG - Intronic
1071098864 10:82011866-82011888 CACCAGCCTCTGAAAGCAGCTGG - Intronic
1071550017 10:86559687-86559709 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1072808250 10:98439334-98439356 CACCAGCCTGTGAAAACAGCTGG + Intronic
1073387091 10:103134752-103134774 CACCAGCCTGTGAAAGCAGCTGG + Intronic
1073776187 10:106788722-106788744 CACCAGCCCATGAAAGCAGCTGG - Intronic
1073942427 10:108713838-108713860 TGCCAGCCCATGAAAGAAGCTGG + Intergenic
1074634784 10:115303024-115303046 AAACAGGTCATGAGAGCAGCAGG - Intronic
1076105983 10:127824104-127824126 CACCAGGCTGAGAAAGCAGAGGG + Intergenic
1076114030 10:127882893-127882915 CAAAAGGCCCTGAAGGCAGCTGG + Intronic
1076464779 10:130671616-130671638 TGCCAGCCCATGAAAACAGCCGG - Intergenic
1076689799 10:132217113-132217135 TGCCAGCCCACGAAAGCAGCCGG + Intronic
1076926766 10:133494605-133494627 CACCAGCCCATAAAAACAGCCGG - Intergenic
1077088424 11:766295-766317 CAGCAGGCCAGGGAGGCAGCTGG + Intergenic
1077422945 11:2461451-2461473 CCCCAGGCCATGGAAGCTGCAGG - Intronic
1077984990 11:7342598-7342620 TGCCAGCCCACGAAAGCAGCCGG - Intronic
1078099570 11:8321942-8321964 TGCCAGGGCATGAGAGCAGCAGG - Intergenic
1078188024 11:9068914-9068936 CACCACGCCAGGAAGGCAGGAGG + Intronic
1078365073 11:10699820-10699842 CACCAGCCCATGAAAGCAACTGG + Intergenic
1078482267 11:11687805-11687827 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1078918858 11:15808090-15808112 CACCAGGCCATCAGCCCAGCAGG + Intergenic
1079181907 11:18201270-18201292 CTCCAGTCCATGAAAGCAGCTGG - Intronic
1079511539 11:21216475-21216497 AACCAGCTCATGAAAGCAGCTGG + Intronic
1079750492 11:24190823-24190845 CACCAGCCCACAAAAGTAGCTGG - Intergenic
1079880535 11:25921640-25921662 CGCCAGCCCATGAAAGTAGCTGG - Intergenic
1079957378 11:26881957-26881979 CACTAGCCCATTAAAGCATCTGG + Intergenic
1079962404 11:26940718-26940740 CACCAGCCCATGAAAACAGGTGG - Intergenic
1080715714 11:34797910-34797932 CAGCAGCCCATGAAAGAAGCTGG + Intergenic
1080717537 11:34818666-34818688 GGCCAGCCCATGAAAGCAGCTGG - Intergenic
1080721812 11:34856535-34856557 CTCCAGGCCTTTAAAGAAGCAGG + Intronic
1080904041 11:36522707-36522729 CACCAGCCTGTGAAAGCAACTGG + Intronic
1080959817 11:37145530-37145552 CACCAGCCTGTGAAAGCAGTTGG - Intergenic
1080966444 11:37219352-37219374 CCCTGGGCCATGTAAGCAGCTGG - Intergenic
1081084962 11:38787846-38787868 CACATGGCCATCAGAGCAGCTGG + Intergenic
1081349075 11:42026700-42026722 CACTAGCCCATAAAAGCAACTGG - Intergenic
1081354457 11:42095539-42095561 CACCAGCCCATGAAAGTAGCTGG + Intergenic
1081388715 11:42503609-42503631 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1081598763 11:44477352-44477374 TGCCAGCCCATGAAAGCAGCCGG + Intergenic
1081746088 11:45473465-45473487 CAGCAGGCTATGAAAACACCTGG - Intergenic
1081961272 11:47139375-47139397 CAGAAGGGCCTGAAAGCAGCTGG + Intronic
1082981943 11:59132043-59132065 TGCCAGCTCATGAAAGCAGCCGG + Intergenic
1085447613 11:76611064-76611086 AAACAGGCCATCAAAGCTGCTGG + Intergenic
1086173274 11:83860286-83860308 TACCAGCCCATGAAAGCAGCTGG + Intronic
1086519193 11:87650747-87650769 TGCCAGCCCATGAAATCAGCTGG - Intergenic
1086740490 11:90362223-90362245 AGGAAGGCCATGAAAGCAGCAGG - Intergenic
1086794599 11:91084346-91084368 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1087255154 11:95945172-95945194 CACCAGTCCATGAAAGCAGCTGG + Intergenic
1087496240 11:98893967-98893989 CATCAGCCTGTGAAAGCAGCTGG - Intergenic
1088426915 11:109714486-109714508 TGCCAGCCCATGAGAGCAGCTGG - Intergenic
1088435196 11:109804640-109804662 AGCCAGACCATGAAAGCAGCTGG - Intergenic
1088755118 11:112879129-112879151 CAACAGGCCTTGAAGCCAGCAGG - Intergenic
1089280924 11:117373812-117373834 CACCAGGCCATGGAAGGACTTGG - Exonic
1090087321 11:123662217-123662239 AGCCAGCCCATGAAAGCAGCTGG - Intergenic
1090316684 11:125797350-125797372 CACCAGCTTGTGAAAGCAGCTGG - Intergenic
1090948448 11:131451868-131451890 TACCAGGGCATGAAGGCATCAGG + Intronic
1091244666 11:134081850-134081872 CACCAGCCCGTGAGAGCAGCGGG + Intronic
1091539734 12:1448902-1448924 TGTCAGCCCATGAAAGCAGCTGG + Intronic
1092459045 12:8670593-8670615 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1093536598 12:20230641-20230663 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1094786851 12:33858978-33859000 CACCAGCCTGTGAAAGCATCTGG - Intergenic
1095847240 12:46759251-46759273 CACCAGCCCATGAAAGCAACTGG + Intergenic
1096904971 12:54926929-54926951 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1097265165 12:57740184-57740206 CACCAGGCCAAGCACGCTGCGGG - Intronic
1097400672 12:59124508-59124530 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1097404789 12:59176645-59176667 CAGCAGCCTGTGAAAGCAGCTGG - Intergenic
1097445682 12:59668293-59668315 CTCCAGCCTGTGAAAGCAGCTGG + Intronic
1097498985 12:60378398-60378420 CACCAACCTGTGAAAGCAGCTGG + Intergenic
1097668789 12:62512585-62512607 CAGCAGGCCATGAAAGCACCTGG - Intronic
1097999150 12:65922255-65922277 CACCAGCCCATGAAAGCAGCTGG + Intronic
1098144916 12:67488318-67488340 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1098294516 12:68990885-68990907 GACCAGCCCATGAAAGCAGTCGG + Intergenic
1098649882 12:72951938-72951960 TGCCAGCCCATGAAAGCAGCCGG - Intergenic
1098761897 12:74435204-74435226 CAGCAGCCCATGAAAGCAGCTGG + Intergenic
1098795830 12:74887607-74887629 TGCCAGTGCATGAAAGCAGCTGG - Intergenic
1098837757 12:75442270-75442292 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1099088673 12:78278598-78278620 TTCCAGCCCATAAAAGCAGCTGG + Intergenic
1099379647 12:81938581-81938603 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1099674619 12:85742788-85742810 CACCAGCCCATGAAAACAGCAGG - Intergenic
1099778605 12:87165729-87165751 CGGCAGCCCATGAAAGCAGCTGG - Intergenic
1100356086 12:93831261-93831283 CCCCAGGCCAGAAAAGGAGCAGG + Intronic
1100657926 12:96667160-96667182 CACCAGCCTGTGAAAGCAGCCGG - Intronic
1100898835 12:99215485-99215507 CACCAGCCTGTGAAAGCAGCTGG + Intronic
1101117779 12:101548996-101549018 CACCAGCCCATGAAAACAGCTGG - Intergenic
1101257915 12:102997931-102997953 CACCAGCACATGAAAGCAGCTGG - Intergenic
1101359075 12:104009186-104009208 TGCCAGCCCATGAAAGCAGCTGG + Intronic
1102484549 12:113247031-113247053 CACCAGGCCACTAGAGCAGGTGG + Intronic
1102758810 12:115367316-115367338 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1103627688 12:122232887-122232909 AGCCAGGCCGGGAAAGCAGCTGG + Exonic
1103880164 12:124159912-124159934 CACATGGCCTTGAAAGCAGCTGG + Intronic
1104240486 12:126984556-126984578 CACCAGCATGTGAAAGCAGCTGG - Intergenic
1104430442 12:128711663-128711685 CACCAGGCCAGGCACGCAGCAGG - Intergenic
1104543130 12:129685735-129685757 TGCCAGCCCATGAAAGCAGCTGG + Intronic
1104829950 12:131743591-131743613 CACCAGCCTGTGAAAGCAGCCGG - Intronic
1105285733 13:19001804-19001826 CACCAACCCATAAAAGCAGCTGG - Intergenic
1105650490 13:22371990-22372012 TGCCACCCCATGAAAGCAGCTGG - Intergenic
1105727981 13:23184761-23184783 CACCAGGCAATGAGGGAAGCCGG - Intronic
1106106654 13:26738924-26738946 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1106618943 13:31355634-31355656 TGCCAGCCCATGAAAGCTGCTGG + Intergenic
1106877354 13:34088463-34088485 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
1107678183 13:42818509-42818531 CGCCAGCCTGTGAAAGCAGCTGG - Intergenic
1108790732 13:53966593-53966615 CGCCAGTCCATGAAAGCAGCTGG + Intergenic
1108872575 13:55005132-55005154 TGCCAGCCCATGAAAGCAGATGG - Intergenic
1109084335 13:57951028-57951050 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1109221761 13:59647202-59647224 CACCACTCCGTGAAAGCAGCTGG + Intergenic
1109277515 13:60319257-60319279 CACCAAGCCAGGAGGGCAGCCGG + Intergenic
1109286054 13:60409430-60409452 CACCAGCCTGTGAAAGCAGCTGG + Intronic
1109294405 13:60512808-60512830 CGCCAGCCCATTAAAGCAGCTGG - Intronic
1109334148 13:60971380-60971402 CACCAGACCATGAAAGCAGCTGG + Intergenic
1109475625 13:62876981-62877003 CACTAGCCTGTGAAAGCAGCCGG - Intergenic
1109649197 13:65303892-65303914 TTCCAGGCCATGAAAGTATCAGG - Intergenic
1109853699 13:68101879-68101901 CGCTAGCCCATGAAAGCAGCTGG - Intergenic
1109859598 13:68179807-68179829 TGCCAGCCCATGAATGCAGCTGG + Intergenic
1110007799 13:70294146-70294168 TGCCAGCCCATGAAAGCAGCAGG + Intergenic
1110166427 13:72448492-72448514 CACCAGCCCATGAAAACAGCTGG + Intergenic
1110208591 13:72946870-72946892 TGCCAGCCCATGAAAGCAGCTGG - Intronic
1110250637 13:73377070-73377092 CGCCAGCCCATGAAAGCAGCTGG - Intergenic
1110341910 13:74402279-74402301 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1110924382 13:81131937-81131959 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1110929177 13:81194130-81194152 TACCAGCCAGTGAAAGCAGCTGG - Intergenic
1111029335 13:82575092-82575114 TACCAGCCCGTGAAAGCAGCTGG - Intergenic
1111081884 13:83321915-83321937 CTCCAGCCCAGGAAAACAGCTGG - Intergenic
1111421678 13:88019224-88019246 CACCAGCCCATGAAAAGAGCCGG + Intergenic
1111551490 13:89818656-89818678 CACCAGCCCATGAAAGTAGCTGG + Intergenic
1111718963 13:91917402-91917424 TGCCAGCCCACGAAAGCAGCTGG - Intronic
1112163003 13:96888839-96888861 TGCCAGCCCATGAAGGCAGCAGG - Intergenic
1112194131 13:97208076-97208098 CACCAGTCCTTGAAAGCAGCTGG - Intergenic
1112512287 13:100020488-100020510 CACCAGCTTGTGAAAGCAGCTGG + Intergenic
1112799278 13:103092714-103092736 CGCCAGCCTGTGAAAGCAGCTGG - Intergenic
1112826548 13:103398481-103398503 CGCCAGCCTGTGAAAGCAGCTGG - Intergenic
1112855785 13:103768192-103768214 CACCAGCCTATGAAAGCAGTTGG - Intergenic
1112882398 13:104123609-104123631 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
1112954532 13:105041863-105041885 CACCAGCCTGTGAAAGCACCTGG - Intergenic
1112995975 13:105575551-105575573 TGCCAGCCTATGAAAGCAGCGGG + Intergenic
1113177723 13:107584852-107584874 TACCAGGCAGTGAAAGAAGCAGG - Intronic
1113284978 13:108836575-108836597 TGCCAGCCCATGAAAGCAGCCGG + Intronic
1114147398 14:19993622-19993644 CGCCAAACCATGAAAGCAGCTGG - Intergenic
1114517228 14:23307894-23307916 CACCAAGCCATGCGGGCAGCTGG + Exonic
1114563369 14:23609652-23609674 CACCAGCCCATAAAAGCAGCCGG - Intergenic
1114797945 14:25738412-25738434 CACCAGCCCATGAAAGCAGTTGG - Intergenic
1114798093 14:25739763-25739785 CACCAGCCCATGGAAGCAGCTGG - Intergenic
1114871573 14:26665570-26665592 TGCCAGCCCGTGAAAGCAGCCGG - Intergenic
1114954911 14:27805520-27805542 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1114973676 14:28067017-28067039 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1114984587 14:28210655-28210677 CACCAGCCCATGAGGGCAGCTGG + Intergenic
1115085746 14:29513000-29513022 CTCCAGCCTGTGAAAGCAGCTGG - Intergenic
1115134843 14:30095940-30095962 CAACAGCCAGTGAAAGCAGCTGG + Intronic
1115149080 14:30262472-30262494 CACAAGGACATGACAGCAGGTGG + Intergenic
1115298420 14:31856848-31856870 CGCCAAACCATGAAGGCAGCCGG - Intronic
1115481697 14:33867390-33867412 CGCAAACCCATGAAAGCAGCTGG - Intergenic
1115609013 14:35034213-35034235 CACCAGCCTGTGAAAGCAGCCGG - Intergenic
1115764022 14:36604334-36604356 CACCAGGCCAGCAAATCAGGTGG + Intergenic
1115840248 14:37461877-37461899 CACCAGCCCATGAAGGCAGTTGG - Intronic
1115929801 14:38478316-38478338 TGACAGCCCATGAAAGCAGCTGG + Intergenic
1116024325 14:39497219-39497241 CACCAGCCCATGAAAGCAGCAGG + Intergenic
1116187032 14:41610024-41610046 TACAAGGCCATGTATGCAGCGGG + Intronic
1116275291 14:42824679-42824701 TGCCAGCCCATAAAAGCAGCTGG + Intergenic
1116415484 14:44672517-44672539 TACCAGCTCATGAAAGCAGCCGG - Intergenic
1116559457 14:46359692-46359714 TCCCAGCCCGTGAAAGCAGCCGG - Intergenic
1116762142 14:49027380-49027402 CACCAGCCTGTGAAGGCAGCTGG + Intergenic
1116784166 14:49269141-49269163 CACCAGCTCATGAAAGCAGCTGG + Intergenic
1117203733 14:53418835-53418857 CAGCAAGCCATGAAAGCATCTGG + Intergenic
1117304372 14:54459496-54459518 CGCCGGCCCATGAAAGCAGCCGG + Intergenic
1117651741 14:57914820-57914842 CTCCAAGCCATGAGAGCTGCTGG - Intronic
1117907562 14:60606019-60606041 CACCAGCCTGGGAAAGCAGCTGG + Intergenic
1117908174 14:60611737-60611759 CACCAGCCTGGGAAAGCAGCTGG - Intergenic
1118239661 14:64044105-64044127 TGCCAGCCTATGAAAGCAGCTGG + Intronic
1118524233 14:66621858-66621880 TACTAGCCAATGAAAGCAGCTGG - Intronic
1118539428 14:66805806-66805828 TGCCAGCCCGTGAAAGCAGCTGG - Intronic
1118933493 14:70264512-70264534 TGTCAGCCCATGAAAGCAGCTGG + Intergenic
1119003629 14:70905497-70905519 CAGCAGGCCAGGAAGGCAGCCGG - Intergenic
1119476016 14:74929321-74929343 CTGCAGGGCATGGAAGCAGCAGG + Intergenic
1119516768 14:75254543-75254565 CACCCGGGCATTAAAGCAGGCGG - Intronic
1120068296 14:80072084-80072106 TGCCAGCCCATGAAGGCAGCTGG - Intergenic
1120324756 14:83009921-83009943 CAGTGGCCCATGAAAGCAGCTGG + Intergenic
1120358080 14:83459367-83459389 CACCAGCCTGTGAAGGCAGCTGG + Intergenic
1120454703 14:84716802-84716824 TGCTAGCCCATGAAAGCAGCCGG + Intergenic
1120621970 14:86775594-86775616 TGCCAGCCCATGAAAGCAGCCGG + Intergenic
1120692278 14:87605972-87605994 CACCAGCCCATAAAATCAGCTGG - Intergenic
1120818001 14:88883353-88883375 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1121182502 14:91940028-91940050 CACCAGCCAAGGAAAGCAGGAGG + Intronic
1121361711 14:93267493-93267515 CACCAGGCAGTGAAAAGAGCTGG - Intronic
1121600367 14:95198952-95198974 CAGCAGGCCATGGAAGCAAGTGG + Intronic
1122294095 14:100695253-100695275 CACCAGGCCAAGGAACAAGCTGG - Intergenic
1122588365 14:102826876-102826898 CACCAGGGCATGGACACAGCAGG - Intronic
1122756531 14:103984821-103984843 TGCCAGCCCATGAAAGCAGCTGG + Intronic
1123054872 14:105564582-105564604 CCCCAGGCCAGGACAGCAGCAGG - Intergenic
1123079316 14:105684161-105684183 CCCCAGGCCAGGACAGCAGCAGG - Intergenic
1123629019 15:22248000-22248022 TGCCAGCCCACGAAAGCAGCTGG + Intergenic
1124062422 15:26306468-26306490 TACCAGCTCATGAAAGCAGCTGG + Intergenic
1124226300 15:27897811-27897833 AACCAGCCCGTGAAGGCAGCGGG + Intronic
1124461669 15:29897617-29897639 TACCAGTCCGTAAAAGCAGCTGG + Intronic
1124831395 15:33153279-33153301 CACCAGGCAATGCAGGGAGCCGG + Exonic
1125839415 15:42784883-42784905 CAGCAGGCCATTTCAGCAGCTGG + Intronic
1126256127 15:46627604-46627626 TGCCAGCCCATAAAAGCAGCTGG + Intergenic
1126873185 15:53011107-53011129 TGCCAGCCCATGAATGCAGCTGG - Intergenic
1126942039 15:53778336-53778358 CACCATCCCGTGAAAGCAGCTGG - Intergenic
1127576207 15:60294979-60295001 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1128688786 15:69707478-69707500 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1128718577 15:69928630-69928652 CACCAGCCCTTGAAGGCAGTTGG - Intergenic
1128882622 15:71257450-71257472 CACTGGGCCCTGAAGGCAGCTGG - Intronic
1129900425 15:79144028-79144050 TACCAGCCCATTAAAGCAGCTGG - Intergenic
1130439200 15:83934151-83934173 CGTCAGCCCATGAAAGCAGCTGG + Intronic
1130824741 15:87532564-87532586 CACCATCCCATCAAAGCAGCTGG - Intergenic
1131556552 15:93404599-93404621 CGCCAGCCTGTGAAAGCAGCTGG + Intergenic
1131830538 15:96352138-96352160 CACCAGGCCGCGAAAGCCGGGGG + Intergenic
1131974734 15:97933335-97933357 TGCCAGTCCATGAAAGAAGCTGG - Intergenic
1132811253 16:1798940-1798962 CACAAGCCTGTGAAAGCAGCTGG + Intronic
1133155661 16:3873754-3873776 CACCCGGCCACCAAACCAGCTGG - Intronic
1133504538 16:6398733-6398755 TGCCAGCCCATGAAAGCAGGTGG - Intronic
1133794212 16:9033230-9033252 CGCCAGCCCGTGAAAGCAGCTGG + Intergenic
1134250654 16:12571564-12571586 CAGCAGGCCATGAAGACAGAAGG - Exonic
1135208895 16:20507255-20507277 TGCCAGGCCATGAAAGCAGCTGG - Intergenic
1135864739 16:26090832-26090854 CACCAGGCCCTGAAAGCACATGG + Intronic
1136642694 16:31580125-31580147 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1136662941 16:31780995-31781017 CACTAGCCTGTGAAAGCAGCTGG + Intronic
1136872442 16:33819946-33819968 CACCAGTCCATGAAAGCAGCTGG - Intergenic
1137265808 16:46868176-46868198 CACCAGCCCATGAAAGTAGCCGG - Intergenic
1137818531 16:51422020-51422042 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1137928290 16:52562600-52562622 TAGTAGGCAATGAAAGCAGCTGG - Intergenic
1137971292 16:52987468-52987490 CACCATGCCCTGAGATCAGCAGG - Intergenic
1138023466 16:53504187-53504209 GAACAGGCCTGGAAAGCAGCTGG - Intronic
1138355860 16:56379873-56379895 CGCCAGTCTGTGAAAGCAGCCGG - Intronic
1139133910 16:64178625-64178647 TGCCAGTCCATGAAAGCAGCTGG + Intergenic
1139166128 16:64566978-64567000 CACCAGCCCATGAAAACAGCTGG + Intergenic
1139172727 16:64650574-64650596 TGCCAGCCTATGAAAGCAGCTGG - Intergenic
1139188262 16:64832847-64832869 CACCAGCCCTTAAAGGCAGCCGG + Intergenic
1139812720 16:69636283-69636305 TGCCAGCCCATGAAAGCAGCTGG - Intronic
1141306049 16:82865145-82865167 CGCCAGCCTGTGAAAGCAGCTGG - Intronic
1141317871 16:82978923-82978945 AAGCTAGCCATGAAAGCAGCCGG + Intronic
1141613710 16:85198313-85198335 CAACAGGGGATGAGAGCAGCTGG + Intergenic
1141975057 16:87510258-87510280 CGCCAGCCCACGAAAGCAGCTGG - Intergenic
1203099730 16_KI270728v1_random:1296122-1296144 CACCAGTCCATGAAAGCAGCTGG + Intergenic
1143721156 17:8810828-8810850 CGCCAGCCCATAAAAGCAGCTGG - Intronic
1146909241 17:36637665-36637687 CATCAGTCCATGAATGCAGAGGG - Intergenic
1147123327 17:38349280-38349302 CCCACGGCCAGGAAAGCAGCTGG + Intergenic
1147348810 17:39824057-39824079 CGCCAGCCCGTGAAAGCAGCTGG + Intronic
1148751323 17:49947361-49947383 CACCAGACCATGACCTCAGCTGG + Intergenic
1149064714 17:52466033-52466055 TGCCAGCCCATGAAAGCAGCCGG + Intergenic
1149101271 17:52909559-52909581 CCCTGGTCCATGAAAGCAGCTGG + Intergenic
1149452271 17:56759048-56759070 CACCAGCCTGTGAGAGCAGCTGG + Intergenic
1149902410 17:60492449-60492471 CGCCAGTCCGTGAAAGCAGCTGG + Intronic
1150987450 17:70214157-70214179 CATCAGCCTATGAAAGCAGCCGG + Intergenic
1151135877 17:71945377-71945399 CGCCAGCCCGTGAAAGCAGCCGG + Intergenic
1151500933 17:74488454-74488476 CGCCAGCCCATGAAAGCAGCTGG - Intergenic
1151724097 17:75874789-75874811 CTCCAGCCCATGAAACCAGACGG + Exonic
1152686614 17:81696824-81696846 CTCCAGGCCATGCCCGCAGCCGG + Exonic
1153084789 18:1271942-1271964 CACCAAGCCATGAAAATAGAGGG - Intergenic
1153199388 18:2633518-2633540 CACTAGCCCATGAAAGCAGGTGG + Intergenic
1153846123 18:9051290-9051312 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
1155764119 18:29605941-29605963 CCCCAGCCCATGAAAGTAGCCGG + Intergenic
1156052315 18:32952073-32952095 TGCCAGTTCATGAAAGCAGCTGG - Intronic
1156065698 18:33140380-33140402 CAGCAGCCCATGAAAGCAGTTGG + Intronic
1156151553 18:34249650-34249672 CACCAGCCTATGAAAGCAGCTGG - Intergenic
1156199223 18:34811076-34811098 CACCAGGCCAGCACAGCTGCTGG - Intronic
1156467610 18:37357682-37357704 CACCAGCCTGTGAAAGCAGCTGG + Intronic
1156809114 18:41225251-41225273 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1156941034 18:42767218-42767240 CACCAGCCCATGAAAGAAGCTGG + Intronic
1157195106 18:45614507-45614529 CACCAGCCTGCGAAAGCAGCAGG + Intronic
1158299199 18:56033093-56033115 CACCAGCCCATGAAAGAAGCTGG - Intergenic
1159083485 18:63761085-63761107 CACCAGGCCATGAAAGCAGCTGG + Intronic
1159265474 18:66073478-66073500 GACCAGCCCATGATAGCAGCTGG - Intergenic
1159410897 18:68073358-68073380 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
1159433394 18:68384612-68384634 TGCCAGCCCATCAAAGCAGCTGG + Intergenic
1159634633 18:70789864-70789886 TGCCAGCCCATGAGAGCAGCTGG - Intergenic
1159731598 18:72034395-72034417 CACCAGCCTGTGAGAGCAGCTGG - Intergenic
1159761253 18:72429769-72429791 TGCCAGCACATGAAAGCAGCAGG - Intergenic
1159767637 18:72509543-72509565 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1159838854 18:73372966-73372988 TGCCAGTCCGTGAAAGCAGCTGG + Intergenic
1160294932 18:77629353-77629375 CACCAGGACAAGAAAGAAGGAGG - Intergenic
1161722370 19:5910226-5910248 CCCCAGGCCAGGAAATCATCCGG - Exonic
1161770692 19:6229168-6229190 CACCTGGCCATGAAAGAAGGTGG + Intronic
1161828085 19:6582949-6582971 CGCCAGCCTGTGAAAGCAGCCGG - Intergenic
1162296189 19:9815359-9815381 CACCAGCCTGTGAAAGCAGCTGG - Intronic
1162596548 19:11633894-11633916 CACCAGCCCGTGAAAGCAGCTGG + Intergenic
1163103897 19:15112552-15112574 CACCTGGCCAAGACTGCAGCAGG - Exonic
1163465885 19:17468585-17468607 TTCCAGGCCCAGAAAGCAGCAGG + Intergenic
1163539749 19:17900814-17900836 CACCAGCCCGTGAAAGCAGCTGG + Intergenic
1163821799 19:19500268-19500290 CACCAGAGCATGTAAGCTGCAGG + Intronic
1164494765 19:28749840-28749862 CACCAGCCCATAAAAGCAGCTGG - Intergenic
1165023806 19:32944828-32944850 CACCAGGTGATGAAAGCTTCAGG + Intronic
1167403527 19:49288886-49288908 CACCAGCCCGTGAAAGCAGCTGG + Intergenic
1168702488 19:58449503-58449525 CACCAGCCCATGAAAGCAGCTGG + Intergenic
924966015 2:77145-77167 TGCCAGCCCATGAAAGCAGTGGG - Intergenic
925080764 2:1063367-1063389 CACCAGCCCTTCAAAGAAGCAGG + Intronic
925245645 2:2380060-2380082 CACCAGCTCACAAAAGCAGCTGG + Intergenic
925805105 2:7640988-7641010 CACCAGCCCGGGAAAGAAGCTGG - Intergenic
926320622 2:11746491-11746513 CAGCAGGCCCTGAAAGCAGCCGG + Intronic
926478641 2:13359292-13359314 AGCCAGTTCATGAAAGCAGCTGG - Intergenic
926526837 2:13991854-13991876 TGCCAGCCTATGAAAGCAGCTGG - Intergenic
926734578 2:16063157-16063179 CACCAGCCCATGAAAGCAGCTGG - Intergenic
926840963 2:17079910-17079932 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
926919448 2:17926256-17926278 CACCAGTCCATGAAAGCAGCTGG - Intronic
927030534 2:19116647-19116669 TGCCAGACCATGAAGGCAGCTGG - Intergenic
927100362 2:19783380-19783402 CACCAGCTCATAAAAGAAGCTGG + Intergenic
927288227 2:21378908-21378930 CACCAGCCCATGAAAGCAGCTGG - Intergenic
927360245 2:22224146-22224168 CACCAGCCCATGAAAGCAACTGG + Intergenic
927389858 2:22582769-22582791 TGTCAGCCCATGAAAGCAGCTGG + Intergenic
928048932 2:27968647-27968669 CACCAGCCCGTGAAGGCAGCTGG + Intronic
928202192 2:29255071-29255093 CACCATGCCTTGAAGGCTGCTGG - Intronic
928566992 2:32562748-32562770 CACCAAGCCATGAAAACACATGG - Intronic
928982931 2:37155192-37155214 GACCAGGCCAAGACAGCAGAAGG - Intronic
929275611 2:40021658-40021680 CACCAGCCTGTAAAAGCAGCTGG + Intergenic
929770981 2:44891817-44891839 CACCACCTCATGAAAGCAGCTGG - Intergenic
930419714 2:51135308-51135330 TGCAAGCCCATGAAAGCAGCTGG + Intergenic
930514833 2:52393533-52393555 CACCAGCCCTTGAAAGCAGCTGG - Intergenic
931033459 2:58210931-58210953 CACCAGCCCATGAACTCAGCCGG - Intronic
931096161 2:58943204-58943226 TGCCAGCCTATGAAAGCAGCTGG + Intergenic
931145102 2:59508442-59508464 CACCAGCCCATGAAAGCAGCCGG + Intergenic
931154652 2:59614674-59614696 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
932090877 2:68805249-68805271 CATCAGGCCAGGAAAGCAGGTGG + Intronic
932847627 2:75151795-75151817 CACCAGCCTGTGAAAGTAGCTGG + Intronic
932904361 2:75733612-75733634 TGCCAGCCTATGAAAGCAGCCGG - Intergenic
932935636 2:76098245-76098267 CACCAGCCGATGAAAGTAGCTGG - Intergenic
933031456 2:77333868-77333890 CACCAGCCCATGAAAGCAGCTGG + Intronic
933064132 2:77772799-77772821 TGCCAGCCCATGAAAGCATCCGG - Intergenic
933418733 2:82022093-82022115 TACCAGTCCATGGAAGCAGCCGG - Intergenic
933508074 2:83204011-83204033 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
933578064 2:84092546-84092568 TGCCAGCCCATGAAAGAAGCTGG - Intergenic
933750966 2:85602048-85602070 CACCAGGCCAGGACAGCTGATGG - Exonic
934482409 2:94663769-94663791 CGCCAGCCCATGAAAGCAGCTGG - Intergenic
934700891 2:96439237-96439259 TACCAGCCTGTGAAAGCAGCTGG + Intergenic
934960532 2:98668711-98668733 CACCAGCCCATGAAAGCAGCTGG + Intronic
935240132 2:101170877-101170899 CAAAAGCCCATGAAAGCAGCTGG + Intronic
935385177 2:102492141-102492163 CACCAGCCCATGAAAGCAGCTGG - Intronic
935448907 2:103187545-103187567 CCCCAGCCCATGAAAGCATCTGG + Intergenic
935481481 2:103595132-103595154 CACCAGTCCATGAAAGCAGCTGG + Intergenic
935625925 2:105172289-105172311 CAAAAGCCCATGAAAGCAGCTGG - Intergenic
936721263 2:115254896-115254918 CGCCAGCCCATGAAAGCAGCCGG - Intronic
936792361 2:116164866-116164888 CACCAGCCCATGAAAGCTGTTGG + Intergenic
936811486 2:116407967-116407989 TGCCAGCGCATGAAAGCAGCAGG + Intergenic
937031496 2:118744508-118744530 TGCCAACCCATGAAAGCAGCTGG - Intergenic
937084104 2:119159100-119159122 CACATGGCCACGAAAGCAGCTGG + Intergenic
937845868 2:126578299-126578321 CAACAGTCCATGAAAGAAGATGG + Intergenic
937896294 2:126979024-126979046 CACCAGTCTATGTAAGCAGAGGG + Intergenic
937935652 2:127241928-127241950 CACCAGCCCTTGAAGGCAGCTGG - Intergenic
938234646 2:129695945-129695967 TGCCAGCCCATGAAAACAGCTGG + Intergenic
938510372 2:131936333-131936355 CGCCAGCCCATGAAAGTAGCTGG - Intergenic
938544452 2:132315087-132315109 CACCAGCCCACAAAAGCAGCCGG - Intergenic
939016947 2:136914014-136914036 CACCAGCCCATGAAAGCAGTCGG + Intronic
939174739 2:138736052-138736074 TGCCAGACCGTGAAAGCAGCTGG - Intronic
939190568 2:138912456-138912478 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
939287653 2:140153978-140154000 CACCAGCCCATGAAAGCAGCCGG - Intergenic
939498240 2:142949192-142949214 CACCAGCCCATGAAGGCAGCTGG - Intronic
939605939 2:144254731-144254753 CACGAGCCCATGGAAGCAGTCGG + Intronic
939703226 2:145420215-145420237 TGCCAGTCCATGAAAGCAACTGG - Intergenic
939833518 2:147100839-147100861 CATCTGGCCATGAAAGGAGAGGG - Intergenic
939842484 2:147205993-147206015 CACCAGCCCACGAAAATAGCTGG - Intergenic
939847747 2:147268659-147268681 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
940430836 2:153588141-153588163 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
940444847 2:153765241-153765263 CGCCAGCCTGTGAAAGCAGCTGG + Intergenic
940547120 2:155102159-155102181 TGCCAGCCCATAAAAGCAGCTGG - Intergenic
940596134 2:155795477-155795499 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
940712196 2:157176162-157176184 TGCCAGCCCGTGAAAGCAGCTGG + Intergenic
940785883 2:157980662-157980684 CACCAGCCCATGAAAGCAGCTGG + Intronic
940814938 2:158287691-158287713 TGCCAGCCCGTGAAAGCAGCCGG - Intronic
941297065 2:163752475-163752497 CACCACGCCATGCTAGCAGATGG + Intergenic
941430587 2:165409277-165409299 TGCCAGCCCATGAAAGTAGCCGG + Intergenic
941477622 2:165968370-165968392 CACCAGCCCGTGACAGCAGCCGG + Intergenic
941649863 2:168081215-168081237 CGCCAGCCCATGAAAGCAGCTGG + Intronic
941682589 2:168414865-168414887 CACCAGCCCCTGAAAGCAGCTGG - Intergenic
941741940 2:169044530-169044552 CACCAGCCCATGAAAGCAGCCGG + Intergenic
941967326 2:171312846-171312868 CACCAGCCCGTGAAAACAACTGG + Intergenic
942118127 2:172749073-172749095 CATCAGCCCCTAAAAGCAGCAGG - Intronic
942517976 2:176773431-176773453 TGCCAGCCCATGAAAGCAGCCGG + Intergenic
942889057 2:180965066-180965088 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
943004701 2:182375560-182375582 TGCCAGCCCATGAAAGCAGCTGG - Intronic
943017338 2:182529159-182529181 TGCCAGTGCATGAAAGCAGCTGG + Intergenic
943423364 2:187698044-187698066 CACCAGCCCATGAAAGTAGCTGG + Intergenic
943527499 2:189035924-189035946 CACCAGACCATGATAGAAACAGG + Intronic
943776794 2:191774657-191774679 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
943788213 2:191901754-191901776 CACCAGCCCATGAAAACAGCTGG + Intergenic
944010100 2:194964851-194964873 TGCCAGCCCATGAAGGCAGCTGG - Intergenic
944115414 2:196180706-196180728 AATCAGGCCCTGGAAGCAGCAGG + Intergenic
944303987 2:198157982-198158004 CGCCAGCCCTTAAAAGCAGCTGG + Intronic
944800212 2:203231488-203231510 TGCCAGCCCGTGAAAGCAGCTGG + Intergenic
944921066 2:204413441-204413463 TGTCAGCCCATGAAAGCAGCTGG + Intergenic
945330694 2:208536405-208536427 CACCAACCCATGAAAGTAGCTGG - Intronic
945644122 2:212467842-212467864 CACCCGCCCATGAAAGCAGCTGG + Intronic
945726576 2:213477409-213477431 CACCAAGCTATGGAAGCAGCTGG + Intronic
946635860 2:221724781-221724803 CACCAGTCAGTGAAAGCAGTTGG + Intergenic
946757598 2:222963139-222963161 CACCAGCTTGTGAAAGCAGCTGG + Intergenic
947888596 2:233595904-233595926 CACCAGCTTGTGAAAGCAGCCGG + Intergenic
948296607 2:236865213-236865235 TGCCAGCCCATGAAACCAGCTGG - Intergenic
948346585 2:237303904-237303926 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
948837736 2:240634284-240634306 CACCAGCCTGTGAAGGCAGCTGG + Intergenic
1168748342 20:263971-263993 CAACAGGCTATGACAGCACCTGG - Intergenic
1169643054 20:7776791-7776813 TGCCAGTCCGTGAAAGCAGCTGG + Intergenic
1169766462 20:9152830-9152852 TGCCAGCCCATGAAAGCATCTGG + Intronic
1170152132 20:13236899-13236921 TGCCAGCCCCTGAAAGCAGCTGG - Intronic
1170337046 20:15281682-15281704 CGCCAGCCCATGAAAGCAGCTGG - Intronic
1170379347 20:15739864-15739886 CATCAGTCCTTGAAGGCAGCAGG - Intronic
1170475061 20:16706396-16706418 TGCCAGCCCATGAAAGCAGCCGG + Intergenic
1170940252 20:20842804-20842826 CACCAGGCCATCTCAGCAGCTGG - Intergenic
1172350953 20:34240270-34240292 CAGCAGGCCATTTTAGCAGCTGG + Intronic
1172380110 20:34482640-34482662 CGCCAGCCCATGAAAGCAGCCGG - Intronic
1172720291 20:36994858-36994880 CACCATCCTGTGAAAGCAGCCGG + Intergenic
1172811953 20:37654484-37654506 TACCAGCCCATGAAAGCAGCTGG - Intergenic
1173172426 20:40738204-40738226 CACAAGGCTCTGAAATCAGCTGG + Intergenic
1174661907 20:52220904-52220926 TGTCAGCCCATGAAAGCAGCTGG - Intergenic
1175195326 20:57239432-57239454 TGCCAGCCCATGAAAGCAGCTGG - Intronic
1175255696 20:57645607-57645629 AGCCTGCCCATGAAAGCAGCTGG + Intergenic
1175667953 20:60876456-60876478 GAACATGCCATGAAGGCAGCTGG - Intergenic
1175789131 20:61730861-61730883 CACTGGGCCATGCAGGCAGCGGG + Intronic
1176301924 21:5102595-5102617 AACCAGCCCAGGAGAGCAGCTGG + Intergenic
1176657664 21:9602340-9602362 TACCAGCCCATGAAAGCAGCTGG - Intergenic
1176783457 21:13226993-13227015 CGCCAGCCCATGAAAGTAGCTGG + Intergenic
1176935322 21:14860541-14860563 CACCAGCCCATGAAAACAGCTGG - Intergenic
1177261335 21:18733460-18733482 CCCCAGCCCGTGAGAGCAGCTGG + Intergenic
1177271134 21:18850641-18850663 TACCAGCCCACAAAAGCAGCTGG + Intergenic
1177339724 21:19783635-19783657 CACCAACCCATGAAAGCAGCTGG - Intergenic
1177393153 21:20502034-20502056 TGCCAGCCCATGAAAGCAACTGG - Intergenic
1177394046 21:20510636-20510658 TGCCAGCCCATGAAAACAGCCGG - Intergenic
1177504258 21:22000468-22000490 TGCCAGCCCATGAAAGCAGCCGG - Intergenic
1177684493 21:24418750-24418772 CACCAGCCCATAAAAGCAGCTGG - Intergenic
1177857862 21:26419785-26419807 AGCTAGCCCATGAAAGCAGCTGG - Intergenic
1178004053 21:28196638-28196660 CTCCAGCCCATGAAAACAGCTGG - Intergenic
1178011292 21:28289919-28289941 TGACAGCCCATGAAAGCAGCTGG - Intergenic
1178013746 21:28318176-28318198 TGACAGCCCATGAAAGCAGCCGG + Intergenic
1178174031 21:30076183-30076205 TGCCAGCTCATGAAAGCAGCTGG + Intergenic
1178261823 21:31106870-31106892 TGCCAGGCCTTGAAAGCAGCTGG - Intergenic
1178392432 21:32210004-32210026 CTCAAGGCCAAGAATGCAGCAGG + Intergenic
1178468983 21:32874914-32874936 TGCCAGCCCATAAAAGCAGCTGG - Intergenic
1178805684 21:35837287-35837309 CACCAGCCCATGAAAGTAGCCGG + Intronic
1179316374 21:40247653-40247675 CACCAGCCCATGAAAGCAGCTGG - Intronic
1179678147 21:42998827-42998849 TGCCAGCCCGTGAAAGCAGCTGG - Intronic
1179855106 21:44159305-44159327 AACCAGCCCAGGAGAGCAGCTGG - Intergenic
1179877767 21:44279866-44279888 CAGCAGGCCATGAACTCACCGGG - Intergenic
1180592047 22:16948220-16948242 CAGCAGGCCATTTCAGCAGCTGG + Intergenic
1181330672 22:22088184-22088206 CACCAGGCCTAGAGAGCAGAGGG - Intergenic
1182182406 22:28363633-28363655 TGCCAGCCCATGAAAGCAGCTGG + Intronic
1182586763 22:31347763-31347785 CACCAGGACACGAAACCAGAAGG - Intergenic
1182815223 22:33156298-33156320 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1182815740 22:33161763-33161785 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1182957723 22:34442898-34442920 CACCAGCACATGAAAGCAGCTGG + Intergenic
1183190061 22:36316469-36316491 CAACAGGCCAAGGAGGCAGCAGG + Intronic
1184311979 22:43651665-43651687 TGTCAGCCCATGAAAGCAGCCGG + Intronic
1184419371 22:44370614-44370636 CAACAGGTCATTAAGGCAGCCGG - Intergenic
1184594716 22:45506780-45506802 CACCAGGTCAGGGAAGCTGCTGG - Intronic
1184677714 22:46052819-46052841 CTTCTGGCCCTGAAAGCAGCCGG - Intronic
1184737938 22:46410083-46410105 CGCCAGGCCATCACGGCAGCCGG + Intronic
949665364 3:6332265-6332287 CACCACCCCGTGAAGGCAGCTGG + Intergenic
950589361 3:13925130-13925152 CACCAGCCCATGAAAGCAGCTGG + Intergenic
950843205 3:15987892-15987914 CACCAGCCCATGAAAGCAGCTGG - Intergenic
951600650 3:24371045-24371067 CACCAAGTCAGGAAACCAGCAGG + Intronic
952125451 3:30294548-30294570 CACTAGGCTAGGAAAGCTGCAGG - Intergenic
952480179 3:33753496-33753518 CGCCAGCCCATGAAAGCACCTGG - Intergenic
952504483 3:33995589-33995611 TACCAGCCTGTGAAAGCAGCTGG - Intergenic
952605852 3:35146001-35146023 CGCCAGCCTGTGAAAGCAGCTGG - Intergenic
952671507 3:35974572-35974594 CACCAGCTCATGAAAGCAGCTGG - Intergenic
952715029 3:36471816-36471838 TGCCAGCCTATGAAAGCAGCTGG - Intronic
953359242 3:42280464-42280486 CACCAGCCCATGAAAGCAGCTGG + Intergenic
953403160 3:42644625-42644647 GACCTGATCATGAAAGCAGCAGG - Intronic
954605541 3:51906426-51906448 CGCCAGCCCATGAAAGCAGCTGG + Intergenic
954759520 3:52863969-52863991 CGCCAGCGCATCAAAGCAGCCGG - Intronic
956169488 3:66421584-66421606 CGCCAGCCTGTGAAAGCAGCTGG - Intronic
956375372 3:68608472-68608494 TGCCAGCTCATGAAAGCAGCTGG - Intergenic
956558763 3:70550806-70550828 CGCCAGCTCATGAAGGCAGCTGG - Intergenic
956714131 3:72063389-72063411 CACCAGCCCATGAAGGCAGCTGG - Intergenic
956736996 3:72245694-72245716 CACCATGCCATTACAGCAGATGG + Intergenic
956938542 3:74131614-74131636 GGCCAGCCCATGAAGGCAGCCGG - Intergenic
957145010 3:76412748-76412770 CGCCAGCCAGTGAAAGCAGCTGG - Intronic
957148677 3:76457486-76457508 TGTCAGTCCATGAAAGCAGCAGG - Intronic
957300956 3:78390599-78390621 CACTAGGCCATGAAGGCAGCTGG + Intergenic
957676729 3:83377188-83377210 TGCCAGCCCATGAAAGCAGCCGG - Intergenic
957704047 3:83756277-83756299 TGCCAGCCCATGAAAACAGCTGG + Intergenic
957929800 3:86863303-86863325 TACCAGCCTGTGAAAGCAGCTGG + Intergenic
958128422 3:89386737-89386759 CACCAGCCCATGAAAGTAAATGG + Intronic
958160796 3:89815121-89815143 CACCAGCCCACAAAAGCAGCTGG - Intergenic
958563845 3:95781897-95781919 CACCAGCCCATGAAGGCAACTGG + Intergenic
958911081 3:99995412-99995434 GGCCAGCCAATGAAAGCAGCTGG - Intronic
958924967 3:100147739-100147761 CACCAGGCCATGCTGCCAGCAGG + Intronic
959004814 3:101008342-101008364 CACCAGCCCATAAAAGCAGCTGG - Intergenic
959104654 3:102051999-102052021 CACCAGCCCATTAAAGCAGCTGG + Intergenic
959228631 3:103618828-103618850 TACCAGCCTATGAAAGCAGCTGG - Intergenic
959284521 3:104390943-104390965 CACTAGCTCATGAAAGCAGCTGG - Intergenic
959606337 3:108245352-108245374 TACCAGCCTATGAAAGCAGCTGG + Intergenic
959624384 3:108433063-108433085 CACCAGCCCATGAAGGCAGCTGG + Intronic
959695635 3:109246282-109246304 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
959777732 3:110188511-110188533 TGCCAGTCCATGAAAGCATCTGG - Intergenic
959838568 3:110948943-110948965 TGCCAGCCCATGAAAGCAACAGG - Intergenic
960060280 3:113313109-113313131 TGCCAGCCCGTGAAAGCAGCTGG + Intronic
960492429 3:118333542-118333564 TGCCAGTCTATGAAAGCAGCTGG + Intergenic
960564361 3:119118031-119118053 TGCCAGCCCGTGAAAGCAGCTGG - Intronic
960626470 3:119686558-119686580 CACCAGCCCATGAAAGTAGCCGG - Intergenic
960963814 3:123090847-123090869 CATCAGGCAATGAAAGCAGGAGG - Intronic
962339451 3:134569613-134569635 TGCCAGCCCATGAAAGCAGCTGG - Intronic
962519245 3:136183148-136183170 AACCAGGCCAAGAAAGAAGCAGG + Intronic
962636673 3:137338781-137338803 TAGCAGCCTATGAAAGCAGCTGG + Intergenic
962659337 3:137585562-137585584 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
962744040 3:138384250-138384272 CGCCAGGCCAGGAGCGCAGCAGG - Intronic
962943743 3:140148901-140148923 AAACAGGCCATGAATGCAGCTGG + Intronic
962946222 3:140173396-140173418 CATCAGCCCATGAAAGCAGCTGG - Intronic
963363182 3:144302977-144302999 TGCCAGCCCATGATAGCAGCTGG - Intergenic
963368391 3:144367338-144367360 CATCAGCCCATGAAAGCAGTTGG - Intergenic
963379245 3:144507202-144507224 CACCAGCCCATGAAAGCAGCCGG - Intergenic
963539437 3:146566825-146566847 AGCCAGCCCAGGAAAGCAGCTGG - Intergenic
963671655 3:148258781-148258803 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
964076634 3:152700511-152700533 TACCAGCCCATGAAAGCAGCTGG - Intergenic
964098548 3:152962415-152962437 CACCGGCCTGTGAAAGCAGCCGG - Intergenic
964236779 3:154540216-154540238 CACCAGGCAATGAAAGCACAGGG - Intergenic
964258280 3:154804712-154804734 CACCAGCCCATGAAAGCAGCTGG - Intergenic
964427448 3:156568553-156568575 TGTCAGCCCATGAAAGCAGCCGG + Intergenic
964520642 3:157563193-157563215 CACCAGCCTGTGAAAACAGCTGG - Intronic
964589237 3:158341794-158341816 TGCTAGCCCATGAAAGCAGCCGG + Intronic
964719326 3:159755991-159756013 CAACAGCCCGTGAAAGCAGCCGG - Intronic
964853418 3:161119357-161119379 GGCCAGCCCATGAAAGCAGCTGG + Intronic
964912605 3:161800854-161800876 CACCAGCCCGCGAAAGCAGCTGG - Intergenic
964978462 3:162647949-162647971 CAGCAGCTCATGAAAGCAGCTGG + Intergenic
965066676 3:163858343-163858365 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
965067810 3:163874957-163874979 CACCACCCCGTGAAAGCAGCCGG + Intergenic
965108374 3:164387959-164387981 TACCAGCCTGTGAAAGCAGCTGG - Intergenic
965198575 3:165629060-165629082 CACCAGCCCATGAAGGCAGCTGG - Intergenic
965386938 3:168056527-168056549 CACGAGCCCATGAAAGCAGCTGG + Intronic
965458133 3:168929631-168929653 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
965662171 3:171053170-171053192 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
965692416 3:171371715-171371737 TACTAGGCCATTAGAGCAGCAGG + Intronic
965838864 3:172880839-172880861 CACCAGTCTGTGAAAGCAGCTGG + Intergenic
965854719 3:173073860-173073882 CTCCAGCCTGTGAAAGCAGCTGG + Intronic
965865099 3:173196150-173196172 CGCCAGCCCATGAAAGCAGCTGG + Intergenic
965897390 3:173594502-173594524 TGCCAGTCCATGAAAGCAGCTGG - Intronic
965931056 3:174043687-174043709 CACCAACCTGTGAAAGCAGCTGG - Intronic
965968871 3:174529375-174529397 AGCAAGTCCATGAAAGCAGCAGG - Intronic
966320302 3:178694794-178694816 CACTAGCCTGTGAAAGCAGCTGG - Intronic
966325208 3:178745933-178745955 TACCAGTCCATGAAAGCAGCTGG - Intronic
966576757 3:181511167-181511189 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
967513618 3:190341054-190341076 TGCCAGCCCATGAAAGCAGCTGG - Intronic
967551519 3:190800955-190800977 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
967633939 3:191778731-191778753 TACCAGCCCATGAAAGCAGCTGG + Intergenic
967749903 3:193101722-193101744 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
968175971 3:196549723-196549745 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
968751418 4:2391259-2391281 CACCAGGACATGAAAGAGGAAGG - Intronic
969936634 4:10688478-10688500 CAGCAGGCCATGCAAGAACCAGG - Intergenic
970057707 4:11994143-11994165 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
970222568 4:13825677-13825699 TGCCAGCCTATGAAAGCAGCTGG + Intergenic
970357453 4:15269840-15269862 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
970577681 4:17443932-17443954 TGCCAGCCCATGAAGGCAGCTGG - Intergenic
970635485 4:18005348-18005370 CATCAGCCTGTGAAAGCAGCTGG - Intronic
970788532 4:19828904-19828926 CACCAGCCCATGAAAGCAGCTGG + Intergenic
970800398 4:19966235-19966257 CACCAGCCCATGAAAGCAGCTGG - Intergenic
970824024 4:20252371-20252393 CGGGAGGCCAGGAAAGCAGCGGG + Intergenic
970977426 4:22057513-22057535 TGCCAGCCCATGAAAACAGCAGG + Intergenic
971071990 4:23104884-23104906 TGCCAGTCCATGAAAGCAGCTGG + Intergenic
971510498 4:27417643-27417665 CATCAGCCTGTGAAAGCAGCTGG + Intergenic
971601410 4:28596206-28596228 CTCAATGCCATGAATGCAGCTGG + Intergenic
971631518 4:28998906-28998928 CGCCAGCCCATGAAAGCAGCAGG + Intergenic
971744879 4:30566700-30566722 CGCCAGCCTGTGAAAGCAGCTGG + Intergenic
971753363 4:30678639-30678661 CACCAGCCCATGAAAGCAGCTGG + Intergenic
971996871 4:33975856-33975878 CACCAACCTGTGAAAGCAGCTGG - Intergenic
972014543 4:34226754-34226776 TGGCAGCCCATGAAAGCAGCTGG + Intergenic
972033687 4:34493983-34494005 CACCAGCCTATGAAAGCAGCTGG + Intergenic
972054305 4:34780589-34780611 AGCCAGCCCATGAAAGCAGCTGG - Intergenic
972190695 4:36587464-36587486 CGCCAGCCCAGGAAAGCAGCTGG + Intergenic
972225354 4:37005525-37005547 CACCAGCCCGTGAAAGCAGCTGG + Intergenic
972301876 4:37792406-37792428 CACCAGCCCGTGAATGCAGCTGG + Intergenic
972361838 4:38332895-38332917 CTCAAGGCCCTGAGAGCAGCTGG + Intergenic
972467557 4:39371609-39371631 CATCAGCCCATGAAAGCAACTGG + Intergenic
972582478 4:40407001-40407023 CACCAGCCTGTGAAAGAAGCTGG + Intergenic
972767170 4:42161965-42161987 CCCCCAGCCAAGAAAGCAGCTGG + Intergenic
972839506 4:42914246-42914268 CATCAGCCTATGAAAGCAGCTGG + Intronic
972857074 4:43120193-43120215 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
973063826 4:45763241-45763263 CACCATTCCATGAAAGCAGCTGG - Intergenic
973604265 4:52571014-52571036 CAGCAGGCCAAGAAACCAGAAGG - Intergenic
974110932 4:57524309-57524331 TACCAGTCCATGAAAGCAGCTGG + Intergenic
974202753 4:58662653-58662675 CACTACCCCATGAAAGCAGCTGG - Intergenic
974341127 4:60616122-60616144 TGCCAACCCATGAAAGCAGCTGG + Intergenic
974517510 4:62936474-62936496 TGTCAGCCCATGAAAGCAGCTGG + Intergenic
974556688 4:63460285-63460307 CACCAGCTTATGAAAACAGCTGG - Intergenic
974679002 4:65137032-65137054 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
974763439 4:66308339-66308361 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
974845979 4:67351574-67351596 CACCAGCCCATGAAAGCAGCTGG - Intergenic
974915543 4:68173906-68173928 CACCAGCCCATGAAAGCAGCTGG + Intergenic
974981851 4:68966904-68966926 CACCAGCCTGTGAAAGCAACTGG - Intergenic
975403385 4:73962623-73962645 CACCAGCCCATGAAATCAGTGGG + Intergenic
975632456 4:76417018-76417040 CACCAGCCCATGAAAGCATCTGG + Intronic
975878211 4:78868882-78868904 GGCCAGCCCATGAAAGCCGCCGG - Intronic
976003658 4:80401822-80401844 TGCCAGCCCATGAAAGCAGTCGG + Intronic
976057138 4:81081731-81081753 CACCAGCCCATGAAGACAGCTGG + Intergenic
976075846 4:81298321-81298343 CACCAGCCCATGAAAACAGCTGG + Intergenic
976259846 4:83135263-83135285 CACCAGCCCGTGAAAGCATCTGG - Intronic
976444846 4:85118320-85118342 AACCAGCCTGTGAAAGCAGCTGG + Intergenic
976503087 4:85814659-85814681 CACCAGCTTGTGAAAGCAGCTGG - Intronic
976674874 4:87692724-87692746 CACCAGCCCATGAAAGCAGCTGG + Intergenic
976881592 4:89932320-89932342 AATCAGCCCATGGAAGCAGCTGG - Intronic
977014036 4:91670168-91670190 CAACAGCCTGTGAAAGCAGCTGG - Intergenic
977189179 4:93978149-93978171 TGCCAGCCCATGAAAGTAGCTGG + Intergenic
977339907 4:95744702-95744724 TGCCAGCCCATGAAATCAGCTGG + Intergenic
977417232 4:96749077-96749099 TGCCAGACCATGAAAGCAGCTGG - Intergenic
977512075 4:97974025-97974047 CACCAGCCCATGAAAGCATCCGG + Intronic
977592523 4:98842434-98842456 TACCAGCCCGTGAAAGCAGCTGG + Intergenic
977996592 4:103502904-103502926 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
978226284 4:106338817-106338839 CTCCAGCCTGTGAAAGCAGCTGG + Intronic
978579493 4:110218020-110218042 CGACAGCCCATAAAAGCAGCTGG - Intergenic
979097815 4:116573428-116573450 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
979367972 4:119848046-119848068 TGCCAGCCCGTGAAAGCAGCTGG - Intergenic
979839788 4:125423714-125423736 CACCAGCCTGTGAAGGCAGCTGG + Intronic
979966936 4:127086919-127086941 CGCCAGCCCATGAAAGCAGCTGG + Intergenic
980006903 4:127552697-127552719 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
980335600 4:131469244-131469266 CACCAGCCCATGAAATCAGCTGG + Intergenic
980430120 4:132683679-132683701 CACCAGCCTGTGAAAACAGCTGG - Intergenic
980707578 4:136519792-136519814 CACTAGCCAGTGAAAGCAGCTGG - Intergenic
980850365 4:138374014-138374036 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
981061741 4:140432150-140432172 CACCAGCCTGTGAAAGCAACTGG + Intergenic
981343380 4:143647969-143647991 TGCCAACCCATGAAAGCAGCTGG + Intronic
981643083 4:146967546-146967568 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
982098714 4:151947349-151947371 CACCAGCTTATGAAAGCAGCTGG + Intergenic
982192992 4:152877211-152877233 CGCCAGCCCATGAGAGCAGCTGG + Intronic
982392856 4:154884661-154884683 AGCCAATCCATGAAAGCAGCTGG - Intergenic
982524928 4:156466542-156466564 TGCCAGCCCGTGAAAGCAGCAGG - Intergenic
982886420 4:160788231-160788253 CACTAGCCTGTGAAAGCAGCTGG + Intergenic
982948852 4:161663599-161663621 TACCAGCCTGTGAAAGCAGCTGG - Intronic
983068082 4:163235471-163235493 CAACAGCCTGTGAAAGCAGCTGG - Intergenic
983337465 4:166415573-166415595 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
983455113 4:167953476-167953498 TACCAGCCCATGAAAGCAGCTGG + Intergenic
983669120 4:170215540-170215562 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
983723790 4:170893274-170893296 CACCAGCCCATGAAAGCAGCTGG - Intergenic
983785958 4:171729553-171729575 TGCTAGTCCATGAAAGCAGCTGG + Intergenic
984026369 4:174547890-174547912 CACCAGCTCATGAAAGCAGCTGG + Intergenic
984416036 4:179459415-179459437 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
984516959 4:180752836-180752858 AACCAGCCCATGAAAGCAGCTGG - Intergenic
984774316 4:183467399-183467421 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
984803244 4:183733440-183733462 CACCAGGCCCTGGAAGTTGCAGG + Intergenic
985225065 4:187751309-187751331 TACCAGCCTGTGAAAGCAGCTGG + Intergenic
985236782 4:187883927-187883949 CAACAAGCAATGAAAGAAGCTGG + Intergenic
985417743 4:189753745-189753767 TACCAGCCCATGAAAGCAGCTGG + Intergenic
985576220 5:674645-674667 CACCAGGACCTGCCAGCAGCTGG + Intronic
986081073 5:4394819-4394841 CACCAGGCCATGCAAGCGGCTGG - Intergenic
986084819 5:4433756-4433778 CACCAGCCCATGACAGCATCAGG - Intergenic
986105468 5:4655654-4655676 TGCCAGCCCATGAAAGCATCTGG - Intergenic
986113884 5:4750343-4750365 CACCAGGCCATGAAAGCAGCTGG - Intergenic
986360750 5:6975776-6975798 CACCAGCTCATGAGGGCAGCTGG + Intergenic
986533243 5:8760788-8760810 CACCAGCCCATGAAAGAAGCTGG + Intergenic
986756709 5:10843683-10843705 CACCAGCCCATGAAAGCAGCTGG - Intergenic
986780270 5:11058737-11058759 TACTAGCCCATGAAGGCAGCTGG + Intronic
986798152 5:11232342-11232364 CATCAGACTGTGAAAGCAGCTGG + Intronic
986907963 5:12518832-12518854 TGCCAGCCCTTGAAAGCAGCTGG - Intergenic
987332964 5:16873397-16873419 CGCCAGCCCATGAAAGCAGCTGG - Intronic
987415254 5:17655459-17655481 CCCCTGGCCACCAAAGCAGCCGG - Intergenic
987478952 5:18428748-18428770 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
987512401 5:18856758-18856780 CACCAACCCATGAAAGCAGCTGG + Intergenic
987727032 5:21716425-21716447 CACCAGCTCATGAAAACAGCCGG - Intergenic
987873326 5:23647967-23647989 CACCAGCACATGAAAGCAGCTGG + Intergenic
987881414 5:23750522-23750544 CACCAGTCCATGAAAGCAAATGG - Intergenic
987894307 5:23925404-23925426 TGCCAGCCCTTGAAAGCAGCAGG - Intergenic
987991512 5:25218223-25218245 AGCCAGCCCATGAAAGCAGCTGG - Intergenic
988070709 5:26284977-26284999 CACCAGCCAGTCAAAGCAGCTGG - Intergenic
988378947 5:30476866-30476888 TGCCAGCCCATGAAGGCAGCTGG - Intergenic
988668894 5:33360059-33360081 CACCAGCCTGTGAAAACAGCTGG - Intergenic
988808963 5:34766313-34766335 CACCAGCCCGTGAGAGCAGCTGG + Intronic
988809231 5:34768074-34768096 CACTAGCCCGTGAGAGCAGCTGG + Intronic
988858509 5:35252669-35252691 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
989203314 5:38787069-38787091 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
989389230 5:40882941-40882963 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
989499539 5:42149736-42149758 CACCAGCCTGTGAAAGCAGATGG + Intergenic
989501839 5:42177212-42177234 CTCCAGCCTTTGAAAGCAGCTGG - Intergenic
990093366 5:52082951-52082973 CACCAACCCGTGAAAGCAGCTGG - Intergenic
990526124 5:56629299-56629321 CACCAGCCAGTGAAAGCAGCTGG + Intergenic
990576013 5:57124192-57124214 CAGCAGGCAAAGAGAGCAGCAGG + Intergenic
990595606 5:57309685-57309707 CACCAGCCCATGAAAGCAGCTGG + Intergenic
991009917 5:61871898-61871920 TGCCAGGCCACGAAAGGAGCCGG - Intergenic
991515508 5:67430618-67430640 CAGCAGGCCATTTCAGCAGCTGG - Intergenic
991696912 5:69281547-69281569 CAAGAAGCCATGAACGCAGCCGG + Exonic
992116635 5:73544577-73544599 CACCAGGACATGAAAGTAAGAGG + Intergenic
992138139 5:73768344-73768366 TATCAGCCCATGAAAGCAGCTGG + Intronic
992817861 5:80463016-80463038 TGCCAGCACATGAAAGCAGCTGG - Intronic
993037019 5:82769601-82769623 CACCAGCCCATGAAAGCAGCTGG + Intergenic
993409313 5:87554457-87554479 TACCAGCCCATGAAAGCAACTGG - Intergenic
993711520 5:91230106-91230128 CACCAGCCCATGAAAGCAGCTGG - Intergenic
993761252 5:91800023-91800045 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
993777042 5:92012492-92012514 TGCCAGCTCATGAAAGCAGCTGG + Intergenic
993920983 5:93801751-93801773 CAGCAGGCCATGCATGAAGCGGG + Intronic
994271461 5:97782613-97782635 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
994285201 5:97956164-97956186 CACCAGCCCGTGAAAGAAGCTGG + Intergenic
994303777 5:98178458-98178480 CGCCAGCCTGTGAAAGCAGCAGG - Intergenic
994439930 5:99789641-99789663 TGCCAGCCCATGAAAGCAGCCGG - Intergenic
994443132 5:99836099-99836121 TCCCAGCCCATGAAAGCAGCTGG + Intergenic
994613525 5:102076228-102076250 CACTAGATCATGAAAACAGCAGG + Intergenic
994621833 5:102172804-102172826 TGCCAGACCATGGAAGCAGCTGG + Intergenic
994831276 5:104786409-104786431 TACCAGCCCATGAAAGCAGCTGG + Intergenic
994905704 5:105839120-105839142 CACCAGCTCCTGAAAGCAGCTGG - Intergenic
994920041 5:106031796-106031818 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
995147825 5:108806511-108806533 CAACAGTCTGTGAAAGCAGCTGG + Intronic
995220418 5:109641621-109641643 CACCAGCCCATGAAAGCAGCTGG + Intergenic
995333787 5:110976018-110976040 GACCAGCCTGTGAAAGCAGCTGG - Intergenic
995370088 5:111408994-111409016 CACCAGCCCATGAAAGCAGTTGG - Intronic
995598067 5:113768097-113768119 CACCAGCCCATTAAAGCAGCTGG + Intergenic
995627190 5:114092393-114092415 AGCCTGGCCGTGAAAGCAGCTGG - Intergenic
995741458 5:115359911-115359933 CATAAGTCCATGAAACCAGCAGG + Intergenic
996030877 5:118702951-118702973 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
996180009 5:120407429-120407451 CACCAACCCATGCAAGCAGCCGG + Intergenic
996468043 5:123826048-123826070 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
996636182 5:125692377-125692399 CGTCAGCCCATGAAAGCAGCCGG + Intergenic
996641673 5:125762046-125762068 CACCAGCCCATGAAGGCAGCCGG + Intergenic
996839855 5:127836330-127836352 GGCCAGCCTATGAAAGCAGCTGG - Intergenic
997056625 5:130451855-130451877 TGCCAGCCCGTGAAAGCAGCTGG - Intergenic
997057393 5:130460485-130460507 CACCAGCTCATAAAACCAGCTGG + Intergenic
997093011 5:130878822-130878844 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
997102030 5:130980261-130980283 CACCCATCCATGAAAGCAACCGG - Intergenic
997426971 5:133809885-133809907 CACCAGGCCTGGAAAATAGCAGG - Intergenic
998151707 5:139761141-139761163 CACCAGGCCTGGCACGCAGCAGG - Intergenic
998543876 5:143009149-143009171 CACCAACCCATGCAACCAGCTGG - Intronic
998578922 5:143349619-143349641 AACAAGGCTATGAAAGCTGCAGG - Intronic
998732891 5:145101247-145101269 CTCCAGGCCCTAAAAGAAGCAGG + Intergenic
998756906 5:145391069-145391091 CATCAGCCCATGAAAGTAGGCGG - Intergenic
998758996 5:145411561-145411583 TGTCAGCCCATGAAAGCAGCTGG - Intergenic
998926026 5:147127483-147127505 CACCAGCCCATGAAAGCAGCTGG - Intergenic
999108052 5:149091288-149091310 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
999736643 5:154517937-154517959 CAGAAGGCCAGGGAAGCAGCAGG + Intergenic
1000226583 5:159267144-159267166 TGCCAGCCCGTGAAAGCAGCTGG + Intronic
1000751054 5:165097336-165097358 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1000768291 5:165318877-165318899 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1001943883 5:175761525-175761547 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1002892980 6:1352812-1352834 CGCCAGCCCATGAAAGCAGCTGG - Intergenic
1003720194 6:8693078-8693100 TGCCAGCCCATGAAAGGAGCTGG + Intergenic
1003909894 6:10733752-10733774 CACCAGACCTGGAGAGCAGCCGG + Intergenic
1004015499 6:11728315-11728337 GGCCAGGCCAGGTAAGCAGCTGG - Intronic
1004269231 6:14179219-14179241 TGCCAAGCCATGAAAGCAGAGGG - Intergenic
1004279874 6:14271492-14271514 TACCAGGCAAGGAGAGCAGCAGG - Intergenic
1005983041 6:30852029-30852051 CACTAGCCCATGAAAGCAGCTGG + Intergenic
1006344203 6:33466734-33466756 CTCCAGCCTCTGAAAGCAGCAGG + Intergenic
1006741743 6:36313651-36313673 CACCAGTCAAAGGAAGCAGCTGG + Intergenic
1007223518 6:40296971-40296993 CACCAGCCCATGAAAGCAGCCGG + Intergenic
1007866149 6:44972448-44972470 CACCAGCCCATGAAAGCATCTGG - Intronic
1007889342 6:45271796-45271818 TTCCACCCCATGAAAGCAGCTGG + Intronic
1008363645 6:50650409-50650431 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1009344360 6:62595522-62595544 TACTAGCCCATGAAAGCAGCCGG + Intergenic
1009396211 6:63203527-63203549 TGCCAGCCCTTGAAAGCAGCTGG - Intergenic
1009490466 6:64284445-64284467 CACCAGCCCATGAAAGCAACTGG - Intronic
1009732217 6:67622676-67622698 CACCAGCCAGTGAAAGCAGTTGG + Intergenic
1009740322 6:67734813-67734835 ACCCAGGCAATGAAAGGAGCTGG - Intergenic
1009826127 6:68867641-68867663 ACACAGCCCATGAAAGCAGCCGG + Intronic
1009900963 6:69807577-69807599 TGCTAGCCCATGAAAGCAGCTGG - Intergenic
1009980406 6:70720372-70720394 CACCAGCCCATGAAAGCAGCCGG - Intronic
1010055165 6:71556491-71556513 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1010555613 6:77275319-77275341 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1010605991 6:77890218-77890240 CACCAGCCCATGAAAGCAGCTGG + Intronic
1010636007 6:78260171-78260193 CACCAGCCCATTAAAGCAGCTGG - Intergenic
1010655663 6:78508030-78508052 TGCCAGCCCATGAATGCAGCTGG + Intergenic
1010845565 6:80702735-80702757 AACCAGCCCATGAAAGAAACTGG + Intergenic
1011041204 6:83032207-83032229 CACCAGCCCATGAAAGAAGCTGG + Intronic
1011169418 6:84489379-84489401 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1011170993 6:84504169-84504191 CACCAGCCTGTGAAAGCAGCTGG + Intergenic
1011287983 6:85745122-85745144 CCCCAGCCTGTGAAAGCAGCTGG + Intergenic
1011355208 6:86466594-86466616 TACCAGTCCAGGAAAGCAGCTGG + Intergenic
1011784253 6:90826543-90826565 CACCAGAGTGTGAAAGCAGCTGG + Intergenic
1011835120 6:91421759-91421781 TCCCAGCCCATGAAAGCAGCTGG + Intergenic
1011844964 6:91552055-91552077 TGCCAGTCCATGAAAGCAGCTGG - Intergenic
1011916443 6:92511877-92511899 CCACCCGCCATGAAAGCAGCAGG + Intergenic
1012074703 6:94669562-94669584 TGCCAGCCCATGAAGGCAGCTGG + Intergenic
1012194137 6:96317951-96317973 CACCAGCCTGTGAAAGCAGTCGG - Intergenic
1012380573 6:98615390-98615412 TGCAAGCCCATGAAAGCAGCTGG - Intergenic
1012569122 6:100700559-100700581 CACCAGCTCGTGAAAGCAGCTGG + Intronic
1012732363 6:102899246-102899268 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1013717234 6:112976390-112976412 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1013918206 6:115367069-115367091 CGCCAGCCTGTGAAAGCAGCTGG + Intergenic
1013990777 6:116252200-116252222 CACAAGCCCAGGAAGGCAGCTGG + Exonic
1014068095 6:117150452-117150474 CGCCAACCCATGAAAACAGCTGG - Intergenic
1014143569 6:117971357-117971379 CAACAGCCTGTGAAAGCAGCTGG - Intronic
1014263867 6:119252110-119252132 AACGAGGGCATGGAAGCAGCTGG + Intronic
1014327565 6:120018120-120018142 CACCTGCCAGTGAAAGCAGCTGG - Intergenic
1014449417 6:121565804-121565826 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1014470036 6:121802132-121802154 TGCTAGCCCATGAAAGCAGCTGG + Intergenic
1014582681 6:123158353-123158375 CACTAGGCCAAGAAAACAGATGG - Intergenic
1014857226 6:126417019-126417041 TGCTAGCCCATGAAAGCAGCTGG + Intergenic
1015110667 6:129588551-129588573 CATCAGCCTGTGAAAGCAGCCGG - Intronic
1015239650 6:131008620-131008642 TGCAAGCCCATGAAAGCAGCCGG + Intronic
1015667492 6:135648315-135648337 CACCAACCTGTGAAAGCAGCTGG - Intergenic
1015667756 6:135650740-135650762 CACCAGACCATGAAAGCAGCTGG + Intergenic
1015713078 6:136162970-136162992 TGCCATCCCATGAAAGCAGCTGG - Intronic
1015852944 6:137593356-137593378 CACCAGCTCGTGAAAGCAGCTGG - Intergenic
1015969561 6:138730563-138730585 CACCAGCCTGTGAAAGCAACTGG - Intergenic
1016020792 6:139234875-139234897 TGCTAGCCCATGAAAGCAGCTGG + Intergenic
1016106555 6:140170993-140171015 CACCAGCCTGTGAAAGCAGCCGG - Intergenic
1016649554 6:146448263-146448285 TGCCAGCCCATGAAAGCAGCAGG - Intergenic
1017388028 6:153908316-153908338 CACCAGCCTCTGAAAGAAGCTGG + Intergenic
1017580501 6:155859579-155859601 CAGCAGCCCATGAAAGCAGCCGG + Intergenic
1017720700 6:157241205-157241227 CACCAGCCCATTAATGAAGCAGG + Intergenic
1018032104 6:159849505-159849527 CACCAGCCTGTGAAAGCGGCTGG + Intergenic
1018041050 6:159922441-159922463 CACCAGCCTGTGAAAACAGCTGG + Intergenic
1018489747 6:164279834-164279856 GACCAGCCCATGAAAGCAGCTGG + Intergenic
1018514346 6:164562305-164562327 TGCCATCCCATGAAAGCAGCTGG + Intergenic
1018527510 6:164729204-164729226 TGCCAGCCCAAGAAAGCAGCTGG + Intergenic
1018585226 6:165350167-165350189 TGCCAGCCCATGCAAGCAGCCGG + Intronic
1018720971 6:166572568-166572590 CAACAGGCAGGGAAAGCAGCCGG - Intronic
1018866852 6:167753060-167753082 CGCCAACCCATGAAAGCAGCTGG - Intergenic
1018922657 6:168186206-168186228 TGCCATCCCATGAAAGCAGCTGG - Intergenic
1019050583 6:169180027-169180049 TGCCAGACCATGAAAGCAGCTGG - Intergenic
1019081673 6:169435433-169435455 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1019098614 6:169609139-169609161 CACCAGGCTGTGAAAGCAGCTGG - Intronic
1020014744 7:4824405-4824427 CACCAGGACCTTAAGGCAGCCGG + Intronic
1020456041 7:8374555-8374577 TGTCAGCCCATGAAAGCAGCTGG + Intergenic
1020493764 7:8822022-8822044 CACCACCCCGTAAAAGCAGCTGG - Intergenic
1020631792 7:10649194-10649216 CGCCAGCCCATGAAAGCAGCTGG - Intergenic
1020731643 7:11888338-11888360 CACCAGCCCATAAGAGCACCGGG + Intergenic
1020780950 7:12516603-12516625 TGCCAGCCCGTGAAAGCAGCTGG + Intergenic
1020782661 7:12535968-12535990 CACCAGCCCATGAAGGCAGCTGG - Intergenic
1021134479 7:16948765-16948787 CACCAATCTGTGAAAGCAGCTGG + Intergenic
1021529774 7:21631744-21631766 CACCAGCCTGTGAAAGCAGCCGG - Intronic
1021565031 7:22008376-22008398 CACCAAGCCATCACAGCAACAGG + Intergenic
1021617742 7:22520237-22520259 TGCCATCCCATGAAAGCAGCTGG + Intronic
1021646650 7:22795799-22795821 TGCCAGTCCATGAAAGCAGCTGG - Intergenic
1021754083 7:23834069-23834091 CACCAGCTTGTGAAAGCAGCTGG + Intergenic
1022042470 7:26593468-26593490 CGCCAGGCCAAGGAAGGAGCTGG - Intergenic
1022171551 7:27836703-27836725 CACCAGCCCCAGAAAGCAGGAGG + Intronic
1022417003 7:30187241-30187263 CATCAGCCCATGAAAGCAACAGG - Intergenic
1022492843 7:30833985-30834007 CACCAGCCCATGAAAGCAACTGG - Intronic
1022678436 7:32522276-32522298 CGCCAGCCCATGAAAGCATCCGG + Intronic
1022927331 7:35069713-35069735 TGCCATCCCATGAAAGCAGCTGG + Intergenic
1022947366 7:35300761-35300783 CAGCTGGCCCTTAAAGCAGCCGG - Intergenic
1023155482 7:37247403-37247425 CACCAGGCCATCTTAGCAGCTGG + Intronic
1023875916 7:44286313-44286335 GACCAGGCCCTGAAGGGAGCAGG + Intronic
1024021393 7:45373913-45373935 CACCAGCCCGTGAAGGCAGCTGG - Intergenic
1024207605 7:47177250-47177272 CACCAGCCCATGAAAGCAGCCGG + Intergenic
1024250521 7:47502573-47502595 CAGCAGGCGATGAGGGCAGCAGG + Intronic
1024438523 7:49387959-49387981 CATCAGCCCATGAAAGCAGCTGG - Intergenic
1026024198 7:66732071-66732093 CACCAGGCCCTGGCAGAAGCAGG - Intronic
1026120075 7:67529247-67529269 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1026278716 7:68903034-68903056 CGCCAGCCTGTGAAAGCAGCTGG + Intergenic
1026888922 7:73970963-73970985 CACCAGGCCCTGGCAGAAGCAGG - Intergenic
1027506408 7:79021370-79021392 CACCAGCCTGTGAAAGCGGCTGG + Intronic
1027624806 7:80532358-80532380 TGCCAGCCTATGAAAGCAGCTGG + Intronic
1027681179 7:81223352-81223374 TTTCAGCCCATGAAAGCAGCTGG + Intergenic
1027733879 7:81907907-81907929 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1028048438 7:86152571-86152593 CACTGACCCATGAAAGCAGCTGG + Intergenic
1028054138 7:86222534-86222556 CATGAGTCCTTGAAAGCAGCTGG - Intergenic
1028189213 7:87825670-87825692 CACCAGCCTGTGAAGGCAGCCGG + Intronic
1028359965 7:89955763-89955785 TGCCAGTCCATGAAAGCAGCTGG - Intergenic
1028374937 7:90135871-90135893 TGCCATCCCATGAAAGCAGCTGG - Intergenic
1028814699 7:95130637-95130659 CACCAGCCCATGAAAGCAGCTGG + Intronic
1029047519 7:97645650-97645672 CTCCAGTCCATGAAAGCAGCTGG + Intergenic
1030015035 7:105210739-105210761 CACCAGTCCCTAAAAGCAGAGGG + Intronic
1030829861 7:114208123-114208145 CACCAGCCCATGAAAGCAACTGG + Intronic
1030986155 7:116244568-116244590 TGCCAGCCAATGAAAGCAGCTGG - Intronic
1031055851 7:116992081-116992103 CACCAGCCCATGAAAGCAGTGGG - Intronic
1031158232 7:118135714-118135736 AGCCAGCCCATGAAAGCAGCCGG + Intergenic
1031170940 7:118291202-118291224 CACCAGCTCATGAAAGCAGCTGG + Intergenic
1031365524 7:120895908-120895930 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1031637606 7:124120289-124120311 TGCCTGCCCATGAAAGCAGCTGG + Intergenic
1031803245 7:126275538-126275560 CACTGGCTCATGAAAGCAGCGGG - Intergenic
1031818815 7:126473222-126473244 TGCCAGCCCATGAAAGCAGCCGG + Intronic
1032179160 7:129660717-129660739 CAACAGCCCATGAAAGCAGCTGG - Intronic
1032661177 7:133985418-133985440 CAGCAGGCCATTTCAGCAGCTGG - Intronic
1033072882 7:138220947-138220969 CGCCAGCCCATGAAAGCAGCCGG + Intergenic
1033225035 7:139554618-139554640 TGCCAGCCCGTGAAAGCAGCCGG + Intergenic
1033419674 7:141194578-141194600 CACCAGCCCAGGAAAGCTGCTGG - Intronic
1033456330 7:141507089-141507111 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1033491979 7:141853150-141853172 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1033730285 7:144171550-144171572 CATCAGCCCATGAATGCAGCCGG + Intergenic
1033905146 7:146193137-146193159 TGCCAGCCCATGAAAGCAGCTGG - Intronic
1034740135 7:153466095-153466117 CACCAGCTCATGAAAGCAGCTGG + Intergenic
1034742961 7:153495457-153495479 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1034751919 7:153576760-153576782 CACCAGCCCGTGAAAGCAGCTGG + Intergenic
1034874465 7:154713236-154713258 TGTCAGCCCATGAAAGCAGCTGG - Intronic
1035135385 7:156698248-156698270 TACCAGCCTGTGAAAGCAGCTGG - Intronic
1036457657 8:8924041-8924063 TGCCAGCCCATGAAAACAGCTGG - Intergenic
1036981527 8:13474577-13474599 CACCAGCCCGTGAAAGCAGCTGG + Intronic
1037263984 8:17037745-17037767 CATCAGCCCATGAAAGCAGCCGG + Intronic
1039121991 8:34157773-34157795 TACCAGCCCATGAAGGCAGCTGG + Intergenic
1039589615 8:38735540-38735562 CACCAGCCCATGGAAGCAGCGGG - Intronic
1039758649 8:40550148-40550170 TCCCAGACCATGAATGCAGCAGG + Intronic
1039826434 8:41178045-41178067 CACCAGACAATCAAACCAGCTGG - Intergenic
1040397154 8:47010954-47010976 TGCCAGCCCATGGAAGCAGCTGG - Intergenic
1040797267 8:51299868-51299890 TGTCAGCCCATGAAAGCAGCTGG - Intergenic
1040925889 8:52682072-52682094 CGCCAGCCTGTGAAAGCAGCCGG + Intronic
1041013879 8:53571519-53571541 CACCAACCTGTGAAAGCAGCTGG + Intergenic
1041494466 8:58470058-58470080 CACCAGCCTATGAAGGCAGCTGG + Intergenic
1041781305 8:61580133-61580155 GACCAGCCCATGAAAGCAGCTGG - Intronic
1041793056 8:61716928-61716950 TATCAGCCCGTGAAAGCAGCTGG - Intergenic
1041852119 8:62403905-62403927 TGCCAGCCCATGAAAGCAGCTGG + Intronic
1041865732 8:62571415-62571437 CATTAGCCCACGAAAGCAGCTGG - Intronic
1041901536 8:62988184-62988206 AACCAGCCCATGAAAGCAGCTGG - Intronic
1042057941 8:64786591-64786613 TGCCAGCCCATGAAAGCAACTGG - Intronic
1042073886 8:64967370-64967392 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1042080559 8:65046698-65046720 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1042169815 8:65980455-65980477 CACCAGCCCATGAAAGTGACTGG + Intergenic
1042266074 8:66910371-66910393 CACCAGCCTGTGAAAGCAGTGGG + Intronic
1042407496 8:68422548-68422570 CACCAGCCTGTGAAAGCAGCTGG - Intronic
1042677921 8:71343202-71343224 CAGCAGGCCATTTCAGCAGCTGG + Intronic
1042883000 8:73515243-73515265 CATGAGGCCATGAAGGCAGGGGG + Intronic
1043092967 8:75928183-75928205 CAACAGCCTGTGAAAGCAGCTGG - Intergenic
1043370372 8:79584107-79584129 TGCCAGCCCATGGAAGCAGCTGG + Intergenic
1043426154 8:80150524-80150546 CGCCAGCCCGTGAAAGCAGCTGG + Intronic
1043660655 8:82736419-82736441 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1044029249 8:87214115-87214137 CACTAGCCCATGAAAGTAGCTGG - Intronic
1044066532 8:87706017-87706039 CGCCAGTCTGTGAAAGCAGCTGG - Intergenic
1045050449 8:98319727-98319749 TGCTAGCCCATGAAAGCAGCTGG - Intergenic
1045053562 8:98349404-98349426 CACCACCCTGTGAAAGCAGCTGG - Intergenic
1045269165 8:100647575-100647597 TACCAGGCTCTGCAAGCAGCTGG + Intronic
1045588126 8:103562560-103562582 TGCCAGCCCATGAAGGCAGCGGG - Intronic
1045597152 8:103669803-103669825 TGCCAGCCCATGAAAGCAGCCGG - Intronic
1045735978 8:105296723-105296745 CACCAGCCCTTTAAAGCAGCTGG - Intronic
1045816975 8:106288122-106288144 CAGCTGGCCATGAAAACAGATGG + Intronic
1045903529 8:107314166-107314188 AACCAGGCTATGAAAGCATAAGG + Intronic
1045940024 8:107728245-107728267 TGCTAGCCCATGAAAGCAGCTGG - Intergenic
1046050175 8:109012960-109012982 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1046129317 8:109947005-109947027 TGCCATACCATGAAAGCAGCTGG + Intergenic
1046243720 8:111531879-111531901 CACCAGCCTGTGAAAGCAGTTGG - Intergenic
1046533013 8:115471958-115471980 TGCCAGACCATGAAGGCAGCTGG - Intronic
1047053487 8:121138941-121138963 CATCAGCCTGTGAAAGCAGCTGG + Intergenic
1047545698 8:125814093-125814115 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1047586949 8:126283153-126283175 CTCCAGTCCATGAAAGCAGCTGG + Intergenic
1047924550 8:129669886-129669908 CACCAGCCCGTGAAGGAAGCTGG + Intergenic
1048028708 8:130610952-130610974 CACCAGGCCATAGATGGAGCAGG + Intergenic
1048478869 8:134769525-134769547 CACCATCCAATGAAAGTAGCTGG - Intergenic
1048669123 8:136696345-136696367 CACTAGCCCATGAAAGCAGCTGG + Intergenic
1048675095 8:136769681-136769703 TGCCAGCCGATGAAAGCAGCTGG - Intergenic
1048706045 8:137154841-137154863 TGCCAGCCCATGAAAACAGCCGG + Intergenic
1048729146 8:137418557-137418579 TGTCAGCCCATGAAAGCAGCTGG - Intergenic
1048781564 8:138007486-138007508 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1049137812 8:140920870-140920892 CAAGAGGCCCTGAAACCAGCAGG - Intronic
1049242464 8:141544914-141544936 CACTTGGCCCTGGAAGCAGCGGG - Intergenic
1049449003 8:142648847-142648869 CACCAGCCCATGAAGGCAGCTGG + Intergenic
1050121605 9:2314166-2314188 CACCAGTCTGTGAAAGCAGCCGG + Intergenic
1050309940 9:4342324-4342346 CACCAGGCCATAAATGGTGCTGG - Intronic
1050695515 9:8275560-8275582 TATCAGGCTGTGAAAGCAGCTGG - Intergenic
1050805428 9:9671071-9671093 TGCCAGCTCATGAAAGCAGCTGG + Intronic
1050905152 9:10994151-10994173 TACCAGCTCGTGAAAGCAGCTGG + Intergenic
1050940559 9:11452189-11452211 TGCCAGTCCATGAAGGCAGCTGG + Intergenic
1051189643 9:14498145-14498167 GACCTTGCCCTGAAAGCAGCAGG + Intergenic
1051382301 9:16471003-16471025 TGCCAGCCCATGAAAGCAGCTGG + Intronic
1051573203 9:18583655-18583677 CACCAGCCAGTAAAAGCAGCCGG + Intronic
1051975383 9:22942002-22942024 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1052053921 9:23882421-23882443 CATCAACCCATGAAAGCAGCTGG - Intergenic
1052105588 9:24510597-24510619 CGCCAGGCCATGAAAGCAGCTGG + Intergenic
1052449658 9:28612422-28612444 CACCAACACATGAAATCAGCTGG + Intronic
1052526903 9:29629930-29629952 TGCCAGCCCAAGAAAGCAGCTGG + Intergenic
1052599018 9:30600171-30600193 CACCAGCCTGTGAAAGCAGTCGG - Intergenic
1052637220 9:31121219-31121241 CATCAGCCCATGAAAGCAGCTGG - Intergenic
1052782513 9:32795746-32795768 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1053384119 9:37673418-37673440 CGCCAGCCCATGAAAGCAGCTGG - Intronic
1053544365 9:39007745-39007767 CACCTGGCTGTGAGAGCAGCAGG - Intergenic
1053792176 9:41694620-41694642 CACCTGGCAATAAGAGCAGCTGG + Intergenic
1053808795 9:41831239-41831261 CACCTGGCTGTGAGAGCAGCAGG - Intergenic
1053925223 9:43047303-43047325 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1054152982 9:61620143-61620165 CACCTGGCAATAAGAGCAGCTGG - Intergenic
1054180586 9:61906640-61906662 CACCTGGCAATAAGAGCAGCTGG + Intergenic
1054288706 9:63259492-63259514 TGCCAGCCCATGAAAGCGGCGGG + Intergenic
1054386531 9:64561029-64561051 TGCCAGCCCATGAAAGCGGCTGG + Intergenic
1054621797 9:67356189-67356211 CACCTGGCTGTGAGAGCAGCAGG + Intergenic
1054657005 9:67674502-67674524 CACCTGGCAATAAGAGCAGCTGG - Intergenic
1054823569 9:69548185-69548207 AACCAAGCAATGCAAGCAGCTGG + Intronic
1055341855 9:75292749-75292771 CGCCAGCCCATGAAAGCAGCTGG - Intergenic
1056064143 9:82915971-82915993 CGCCAGCCTGTGAAAGCAGCCGG - Intergenic
1056283980 9:85069725-85069747 CACCAGCCTGTGAAAGCAGCCGG + Intergenic
1056842900 9:90013202-90013224 CAGCAGGCCATGGAAGCAGGTGG - Intergenic
1056915019 9:90738825-90738847 CACAAGCCCATGAAAGCAGCTGG - Intergenic
1056947618 9:91013354-91013376 CACCTGGCCATGACTGGAGCAGG + Intergenic
1057441432 9:95086472-95086494 CACGTGGCCATGACACCAGCAGG - Intronic
1058086414 9:100752957-100752979 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1058174581 9:101722530-101722552 CGCCAGCCTGTGAAAGCAGCTGG + Intronic
1058649254 9:107159627-107159649 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1058834413 9:108848464-108848486 CAACAGCCTGTGAAAGCAGCCGG - Intergenic
1059082545 9:111265738-111265760 TGCCAGCCCATGAAAGCATCTGG - Intergenic
1059195763 9:112369316-112369338 CATCAGCCTGTGAAAGCAGCTGG + Intergenic
1059562383 9:115347846-115347868 CACCAGCCCATGAAAGCAGCTGG - Intronic
1059986336 9:119823944-119823966 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1060030357 9:120209688-120209710 GATCAGGCCCTGAAAGCAACAGG - Intergenic
1060312001 9:122470686-122470708 TGCCAGCCCATGAATGCAGCGGG + Intergenic
1060622757 9:125082573-125082595 TGCCAGCCCATGAAAGCAGCCGG + Intronic
1061672104 9:132194521-132194543 CACCATGCCAGGACAGCAGAGGG - Intronic
1061782389 9:133003802-133003824 CCCCAAGCCAAGAAAACAGCGGG + Intergenic
1062034129 9:134375302-134375324 AACCAGGCCAGGAAGACAGCAGG - Intronic
1062157840 9:135063597-135063619 CGCCAGCCTGTGAAAGCAGCTGG - Intergenic
1062330717 9:136043486-136043508 CAGCAGCCCGTGAGAGCAGCAGG - Intronic
1062356583 9:136167499-136167521 GATCAGGCCTGGAAAGCAGCAGG - Intergenic
1062746751 9:138217860-138217882 GCCCAGGTCATGAAAGGAGCTGG - Intergenic
1203635392 Un_KI270750v1:105914-105936 TACCAGCCCATGAAAGCAGCTGG - Intergenic
1185569366 X:1121495-1121517 CAGCAGGTCCTGAATGCAGCTGG - Intergenic
1186797600 X:13062043-13062065 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1186980729 X:14954998-14955020 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1187555235 X:20344916-20344938 CACCAGTCCATGCAAGCAGCTGG + Intergenic
1187796146 X:23006361-23006383 TTCGAGCCCATGAAAGCAGCCGG - Intergenic
1188162394 X:26819754-26819776 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1188221460 X:27546339-27546361 CGCCAGCCCATATAAGCAGCTGG - Intergenic
1188325480 X:28796683-28796705 CACTAGCCCGTGAAAGCAGCTGG - Intronic
1188392777 X:29641433-29641455 AACCAGGCCATGTAAACACCTGG - Intronic
1188889735 X:35595370-35595392 CACCAGCCCGTGAAAACTGCTGG + Intergenic
1189120030 X:38384713-38384735 GACCAGGCCCCCAAAGCAGCTGG - Intronic
1189176516 X:38963194-38963216 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1189788761 X:44583620-44583642 TGCCAGCCCGTGAAAGCAGCTGG + Intergenic
1189922136 X:45912897-45912919 CCCCAGGCTGTGAAGGCAGCAGG - Intergenic
1190269620 X:48852611-48852633 CACAAGCCCATGAAAGCTGCTGG - Intergenic
1190513239 X:51195407-51195429 CACTAGCACATGAAAGCAGCTGG - Intergenic
1190531765 X:51385950-51385972 CATCAGCCCACAAAAGCAGCTGG - Intergenic
1191116384 X:56857491-56857513 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1191606855 X:63071865-63071887 CGCCAGCACATGAAAGCAGATGG - Intergenic
1191986606 X:66987915-66987937 CACCAGCTTGTGAAAGCAGCTGG - Intergenic
1191998981 X:67127561-67127583 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1192008586 X:67242983-67243005 CACAAGCCTGTGAAAGCAGCTGG + Intergenic
1193076275 X:77359440-77359462 CCCAAGGCCATGAAATCATCTGG + Intergenic
1193308017 X:79972516-79972538 CACCAGCCCATGAAAGCAGCAGG + Intergenic
1193320448 X:80115177-80115199 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1193370772 X:80694514-80694536 CGCCAGCCTGTGAAAGCAGCTGG + Intronic
1193449229 X:81645613-81645635 TGCAAGCCCATGAAAGCAGCTGG + Intergenic
1193455793 X:81729939-81729961 TACCAGCCCATGAAAGCAGCTGG + Intergenic
1193459680 X:81775614-81775636 CACCAGCCAGTGAAATCAGCTGG - Intergenic
1193460503 X:81786247-81786269 CACCAGCCCATGAAATCAGCTGG - Intergenic
1193519547 X:82512088-82512110 CACCAGCCCGTGAAAGCTTCAGG - Intergenic
1193797277 X:85891845-85891867 CACCAGCCTGTGAAAGCAGCCGG + Intronic
1193918796 X:87400467-87400489 CAGCAGCCTATGAAAGCAGCCGG + Intergenic
1194042785 X:88962593-88962615 CACCAGCCCATGAAATCATCCGG + Intergenic
1194082863 X:89489909-89489931 TGCCAGCACATGAAAGCAGCTGG - Intergenic
1194145267 X:90254590-90254612 TACCAGCCCAGGAAAGCAGCTGG - Intergenic
1194320645 X:92441881-92441903 CACCAGCCCACGAAAGCAGTTGG + Intronic
1194321169 X:92447812-92447834 CAACAGCCTATGAAAGCAGCTGG + Intronic
1194377256 X:93151606-93151628 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1194442951 X:93955247-93955269 TGCCAACCCATGAAAGCAGCAGG + Intergenic
1194500543 X:94676360-94676382 GGACAGCCCATGAAAGCAGCTGG - Intergenic
1194578436 X:95641683-95641705 TGCCAGCCCATGAAAGCAGCTGG - Intergenic
1194625946 X:96227141-96227163 CGCCAGCCCATGAAAGCTGCTGG - Intergenic
1194778153 X:97991085-97991107 TACCAGTCCATGAAAGCAGCTGG - Intergenic
1194860301 X:98991008-98991030 CACCAGCCCATGAAAGTAGCTGG - Intergenic
1194864957 X:99054191-99054213 CACCAGTCTGTGAAAGCAGCTGG + Intergenic
1194982371 X:100453548-100453570 CACGAGCCCATGAAAGCAATGGG + Intergenic
1195333672 X:103829107-103829129 CACCAGTGCATGAAAGGAGGTGG - Intronic
1195457403 X:105084320-105084342 CACCAGCCTGTGAAAACAGCTGG + Intronic
1196036334 X:111149264-111149286 CAGCAGCCTGTGAAAGCAGCCGG - Intronic
1196173694 X:112617250-112617272 CACTAGCCTGTGAAAGCAGCTGG + Intergenic
1196478222 X:116113346-116113368 TGCCAGCCCATGAATGCAGCTGG - Intergenic
1196503382 X:116411540-116411562 TGCCAGCCCATGAAAGCAGCCGG + Intergenic
1196558604 X:117120775-117120797 TGCCAGCCCATGAAAGCAGCAGG - Intergenic
1196903481 X:120409661-120409683 CACCAGCCTATGAAAGCAGCTGG - Intergenic
1196930373 X:120675846-120675868 TGCCAGCCCATGAAAGCAACTGG - Intergenic
1197023425 X:121717838-121717860 CACCAGGCCATGAAAGCAGCTGG - Intergenic
1197040720 X:121932380-121932402 TGCCAGCCCGTGAAAGCAGCTGG - Intergenic
1197074709 X:122340794-122340816 CACCAGCCTGGGAAAGCAGCCGG - Intergenic
1197092602 X:122556505-122556527 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1197160518 X:123317703-123317725 CACTAGCCCATGAAAGCAGCTGG - Intronic
1197442806 X:126511732-126511754 CACCAGCCTGTGAAAACAGCTGG - Intergenic
1197499129 X:127222461-127222483 CACCAGCCCATGAAAGCAGCTGG + Intergenic
1197561196 X:128024397-128024419 TGCTAGCCCATGAAAGCAGCCGG - Intergenic
1197578748 X:128255816-128255838 CAGCAGCCCATAAAAGCAACTGG - Intergenic
1197581945 X:128294565-128294587 TGCCAGCCCGTGAAAGCAGCTGG + Intergenic
1197798117 X:130319433-130319455 TGCCAGCCCATGAAAGCAGCTGG + Intergenic
1197856547 X:130919325-130919347 TGCCAGTCCATCAAAGCAGCCGG - Intergenic
1198497112 X:137203942-137203964 TGTCAGCCCATGAAAGCAGCCGG - Intergenic
1198569820 X:137942670-137942692 CTCTAGCCCATGAAAGCAGCTGG + Intergenic
1198834993 X:140795463-140795485 CACCAGCCTGTGAAAGCAGCCGG - Intergenic
1198919309 X:141708059-141708081 CACCAGCCTGTGAAAGCAGCTGG - Intergenic
1199112860 X:143955587-143955609 TGCCAGCCTATGAAAGCAGCTGG + Intergenic
1199170899 X:144733381-144733403 CACTAGCCCGTGAAAACAGCTGG - Intergenic
1199220282 X:145309290-145309312 TGCCAGCCCGTGAAAGCAGCCGG - Intergenic
1199278134 X:145970259-145970281 TACCAGCCTGTGAAAGCAGCTGG + Intergenic
1199284304 X:146039002-146039024 TGCCAGCTCATGAAAGCAGCTGG + Intergenic
1199291065 X:146105602-146105624 CACCAGCCCATGAAAGCAGCTGG - Intergenic
1199349873 X:146787956-146787978 TGCCAGCCCATGAAAGTAGCTGG + Intergenic
1199357218 X:146876086-146876108 TGCAAGCCCATGAAAGCAGCTGG + Intergenic
1199462698 X:148101541-148101563 GGCCAGCCCCTGAAAGCAGCCGG + Intergenic
1199476780 X:148254851-148254873 TGCAAGCCCATGAAAGCAGCTGG + Intergenic
1199566136 X:149217439-149217461 CCCCAGCCCATGAAAGAAGCTGG + Intergenic
1199687018 X:150273749-150273771 TGCCAGCCCGTGAAAGCAGCTGG + Intergenic
1199908713 X:152261697-152261719 CTCCAGCCCATGAAAACAACTGG - Intronic
1199999365 X:153049751-153049773 CACCGGCCTGTGAAAGCAGCTGG + Intergenic
1200380769 X:155834885-155834907 TGCGAGTCCATGAAAGCAGCTGG + Intergenic
1200435515 Y:3145781-3145803 TGCCAGCACATGAAAGCAGCTGG - Intergenic
1200491028 Y:3823888-3823910 TACCAGCCCAGGAAAGCAGCTGG - Intergenic
1200628759 Y:5555017-5555039 CACCAGCCCACGAAAGCAGTTGG + Intronic
1200629284 Y:5560959-5560981 CAACAGCCTATGAAAGCAGCTGG + Intronic
1202174114 Y:22081803-22081825 CGCCATGCCAAGGAAGCAGCAGG + Intronic
1202217246 Y:22504579-22504601 CGCCATGCCAAGGAAGCAGCAGG - Intronic
1202325940 Y:23691480-23691502 CGCCATGCCAAGGAAGCAGCAGG + Intergenic
1202544831 Y:25978574-25978596 CGCCATGCCAAGGAAGCAGCAGG - Intergenic