ID: 986113885

View in Genome Browser
Species Human (GRCh38)
Location 5:4750359-4750381
Sequence AGCTGTAGACACTCAACACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986113885_986113890 22 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113890 5:4750404-4750426 TGTCAGTGGATCTACCATTCTGG 0: 857
1: 1226
2: 1663
3: 1355
4: 1012
986113885_986113892 24 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113892 5:4750406-4750428 TCAGTGGATCTACCATTCTGGGG 0: 788
1: 1110
2: 1492
3: 1250
4: 917
986113885_986113891 23 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113891 5:4750405-4750427 GTCAGTGGATCTACCATTCTGGG 0: 823
1: 1178
2: 1629
3: 1350
4: 1090
986113885_986113889 8 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113889 5:4750390-4750412 CACATGGTGCAAGGTGTCAGTGG No data
986113885_986113886 -8 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113886 5:4750374-4750396 CTACAGCTTTTCCAAGCACATGG No data
986113885_986113893 29 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113893 5:4750411-4750433 GGATCTACCATTCTGGGGTCTGG 0: 1268
1: 1929
2: 1766
3: 1012
4: 639
986113885_986113887 -1 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986113885 Original CRISPR AGCTGTAGACACTCAACACC AGG (reversed) Intergenic
No off target data available for this crispr