ID: 986113887

View in Genome Browser
Species Human (GRCh38)
Location 5:4750381-4750403
Sequence TTTTCCAAGCACATGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986113880_986113887 20 Left 986113880 5:4750338-4750360 CCCTCCCAGCTGCTTTCATGGCC No data
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113883_986113887 16 Left 986113883 5:4750342-4750364 CCCAGCTGCTTTCATGGCCTGGT 0: 3
1: 86
2: 383
3: 853
4: 1264
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113881_986113887 19 Left 986113881 5:4750339-4750361 CCTCCCAGCTGCTTTCATGGCCT 0: 4
1: 175
2: 315
3: 852
4: 1363
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113884_986113887 15 Left 986113884 5:4750343-4750365 CCAGCTGCTTTCATGGCCTGGTG 0: 3
1: 71
2: 143
3: 331
4: 605
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113885_986113887 -1 Left 986113885 5:4750359-4750381 CCTGGTGTTGAGTGTCTACAGCT No data
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data
986113878_986113887 23 Left 986113878 5:4750335-4750357 CCTCCCTCCCAGCTGCTTTCATG 0: 149
1: 263
2: 597
3: 852
4: 1306
Right 986113887 5:4750381-4750403 TTTTCCAAGCACATGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986113887 Original CRISPR TTTTCCAAGCACATGGTGCA AGG Intergenic
No off target data available for this crispr