ID: 986130902

View in Genome Browser
Species Human (GRCh38)
Location 5:4929105-4929127
Sequence TGCAAGGCAGGCTCTTCACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986130899_986130902 -6 Left 986130899 5:4929088-4929110 CCATTGATTTGCATTCATGCAAG No data
Right 986130902 5:4929105-4929127 TGCAAGGCAGGCTCTTCACAAGG No data
986130897_986130902 30 Left 986130897 5:4929052-4929074 CCATCAAACATGTCTTGTGCAGA No data
Right 986130902 5:4929105-4929127 TGCAAGGCAGGCTCTTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986130902 Original CRISPR TGCAAGGCAGGCTCTTCACA AGG Intergenic
No off target data available for this crispr