ID: 986131046

View in Genome Browser
Species Human (GRCh38)
Location 5:4930515-4930537
Sequence CCTTCTTTGCTGGGGCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986131046_986131053 2 Left 986131046 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG No data
Right 986131053 5:4930540-4930562 GAGAAGCTGAAAGACATTGGAGG No data
986131046_986131056 23 Left 986131046 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG No data
Right 986131056 5:4930561-4930583 GGCTGGGATACTATTTGCATAGG No data
986131046_986131052 -1 Left 986131046 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG No data
Right 986131052 5:4930537-4930559 GGAGAGAAGCTGAAAGACATTGG No data
986131046_986131054 6 Left 986131046 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG No data
Right 986131054 5:4930544-4930566 AGCTGAAAGACATTGGAGGCTGG No data
986131046_986131057 26 Left 986131046 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG No data
Right 986131057 5:4930564-4930586 TGGGATACTATTTGCATAGGAGG No data
986131046_986131055 7 Left 986131046 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG No data
Right 986131055 5:4930545-4930567 GCTGAAAGACATTGGAGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986131046 Original CRISPR CCTTCTTTGCTGGGGCTGCC AGG (reversed) Intergenic
No off target data available for this crispr