ID: 986131686

View in Genome Browser
Species Human (GRCh38)
Location 5:4937873-4937895
Sequence CTGAAGGAGCAGGTGGAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986131686_986131690 -4 Left 986131686 5:4937873-4937895 CCATGCTCCACCTGCTCCTTCAG No data
Right 986131690 5:4937892-4937914 TCAGCAGCCTCCACCTCCTCTGG No data
986131686_986131695 22 Left 986131686 5:4937873-4937895 CCATGCTCCACCTGCTCCTTCAG No data
Right 986131695 5:4937918-4937940 TTACTCACTATCCTGCATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986131686 Original CRISPR CTGAAGGAGCAGGTGGAGCA TGG (reversed) Intergenic
No off target data available for this crispr