ID: 986140492

View in Genome Browser
Species Human (GRCh38)
Location 5:5025618-5025640
Sequence TCCATGCCCTGTGTGGCTCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986140492_986140500 5 Left 986140492 5:5025618-5025640 CCGAGAGCCACACAGGGCATGGA No data
Right 986140500 5:5025646-5025668 CTCCCCACAGCCAAGGGAGGTGG No data
986140492_986140494 -2 Left 986140492 5:5025618-5025640 CCGAGAGCCACACAGGGCATGGA No data
Right 986140494 5:5025639-5025661 GAAGCCCCTCCCCACAGCCAAGG No data
986140492_986140505 29 Left 986140492 5:5025618-5025640 CCGAGAGCCACACAGGGCATGGA No data
Right 986140505 5:5025670-5025692 GAGTGAATGTGCTACCCAGCCGG No data
986140492_986140506 30 Left 986140492 5:5025618-5025640 CCGAGAGCCACACAGGGCATGGA No data
Right 986140506 5:5025671-5025693 AGTGAATGTGCTACCCAGCCGGG 0: 4
1: 19
2: 69
3: 160
4: 334
986140492_986140497 2 Left 986140492 5:5025618-5025640 CCGAGAGCCACACAGGGCATGGA No data
Right 986140497 5:5025643-5025665 CCCCTCCCCACAGCCAAGGGAGG No data
986140492_986140495 -1 Left 986140492 5:5025618-5025640 CCGAGAGCCACACAGGGCATGGA No data
Right 986140495 5:5025640-5025662 AAGCCCCTCCCCACAGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986140492 Original CRISPR TCCATGCCCTGTGTGGCTCT CGG (reversed) Intergenic
No off target data available for this crispr