ID: 986144973

View in Genome Browser
Species Human (GRCh38)
Location 5:5069464-5069486
Sequence CCTACAACGGAGTACTTGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986144973_986144979 10 Left 986144973 5:5069464-5069486 CCATCCAAGTACTCCGTTGTAGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 986144979 5:5069497-5069519 AAATTGCAGGGTTTGCTGCCTGG 0: 1
1: 0
2: 1
3: 19
4: 230
986144973_986144978 -2 Left 986144973 5:5069464-5069486 CCATCCAAGTACTCCGTTGTAGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 986144978 5:5069485-5069507 GGATTCAAAAGCAAATTGCAGGG 0: 1
1: 0
2: 2
3: 14
4: 227
986144973_986144977 -3 Left 986144973 5:5069464-5069486 CCATCCAAGTACTCCGTTGTAGG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 986144977 5:5069484-5069506 AGGATTCAAAAGCAAATTGCAGG 0: 1
1: 0
2: 3
3: 13
4: 279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986144973 Original CRISPR CCTACAACGGAGTACTTGGA TGG (reversed) Intergenic
908973915 1:69873523-69873545 CCTACAACAGAGGATGTGGAGGG + Intronic
911819277 1:102396144-102396166 CCTACATCTGAATATTTGGAAGG - Intergenic
1065593328 10:27287782-27287804 CCTACACTGAAGTACTTGCAAGG - Intergenic
1065657047 10:27962505-27962527 CCTACACTGAAGTACTTGCAAGG + Intronic
1077573067 11:3355713-3355735 CCTACAACAGAGACCTGGGAAGG + Intronic
1087022810 11:93620311-93620333 CCTACAGCCCAGTACTTGTATGG - Intergenic
1113331191 13:109329470-109329492 CCCACATCTGAGTACCTGGAAGG - Intergenic
1113580301 13:111423979-111424001 CCTAAAACGCAGTGCCTGGAAGG - Intergenic
1119808424 14:77497866-77497888 CCTACAGCTTAGTACATGGAAGG + Intronic
1120647739 14:87093574-87093596 TATACAACAGAATACTTGGAAGG + Intergenic
1130655211 15:85787798-85787820 CATACAACGGAGGACTAGAAGGG + Intronic
1135729454 16:24882178-24882200 CCTACCACGTAGAACTTGGTGGG + Intronic
1146631771 17:34475173-34475195 CCTAGCAGGGAGTTCTTGGAGGG - Intergenic
1149081799 17:52666672-52666694 CCTACAATGTAGTGCTTTGAAGG - Intergenic
1163883430 19:19946567-19946589 CCTACAACTGAGACCTGGGAGGG - Intergenic
925962637 2:9032861-9032883 CATAGAATGAAGTACTTGGAAGG - Intergenic
927656280 2:24949314-24949336 CCCACAAGGGAGTCCTGGGAAGG + Intronic
939042714 2:137209962-137209984 CCTACAAAGGGGTGCCTGGAAGG + Intronic
943847121 2:192665098-192665120 CATACAAATAAGTACTTGGATGG + Intergenic
1175862697 20:62158761-62158783 CATACACCGGAACACTTGGAGGG + Intronic
1176671380 21:9738217-9738239 CCCAAAATGGTGTACTTGGAGGG + Intergenic
1181098172 22:20520465-20520487 CCTACTACAGAGCACTTGGCAGG - Intronic
1184230566 22:43156245-43156267 CATACAACGGGGGACCTGGATGG + Intronic
968435170 4:581686-581708 CCTGCAAAGGAGAACTTGGGGGG - Intergenic
980273329 4:130615547-130615569 CCTACATCAGAGAACTTTGAAGG - Intergenic
986144973 5:5069464-5069486 CCTACAACGGAGTACTTGGATGG - Intergenic
997885979 5:137630298-137630320 CCTACACTGGAGGACCTGGAGGG - Intronic
1021658924 7:22898921-22898943 CACACAAGGGAGTGCTTGGAAGG - Intergenic
1023977200 7:45039352-45039374 CCCACAAAGGAATTCTTGGAAGG + Intronic
1028849930 7:95526645-95526667 ACTGCAAAGGATTACTTGGAAGG + Intronic
1041612398 8:59867034-59867056 CCGACAACAGAGTATTTCGAAGG - Intergenic
1047209392 8:122828746-122828768 CCTGCAAAGGGGTTCTTGGAAGG + Intronic
1048422398 8:134290390-134290412 CATACAACAGACTACTTGGCTGG + Intergenic
1049653319 8:143786782-143786804 CATACAAGGGAGAACTTGGAGGG + Intergenic
1186682809 X:11893765-11893787 CCTAGAAGGGAATCCTTGGATGG - Intergenic