ID: 986146663

View in Genome Browser
Species Human (GRCh38)
Location 5:5084254-5084276
Sequence CAGGTTAGCAGGCCTGTTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986146652_986146663 6 Left 986146652 5:5084225-5084247 CCAGTCCCAGAAGTGCCCGCCTG No data
Right 986146663 5:5084254-5084276 CAGGTTAGCAGGCCTGTTACTGG No data
986146657_986146663 -9 Left 986146657 5:5084240-5084262 CCCGCCTGGCAGCCCAGGTTAGC No data
Right 986146663 5:5084254-5084276 CAGGTTAGCAGGCCTGTTACTGG No data
986146654_986146663 1 Left 986146654 5:5084230-5084252 CCCAGAAGTGCCCGCCTGGCAGC No data
Right 986146663 5:5084254-5084276 CAGGTTAGCAGGCCTGTTACTGG No data
986146658_986146663 -10 Left 986146658 5:5084241-5084263 CCGCCTGGCAGCCCAGGTTAGCA No data
Right 986146663 5:5084254-5084276 CAGGTTAGCAGGCCTGTTACTGG No data
986146655_986146663 0 Left 986146655 5:5084231-5084253 CCAGAAGTGCCCGCCTGGCAGCC No data
Right 986146663 5:5084254-5084276 CAGGTTAGCAGGCCTGTTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986146663 Original CRISPR CAGGTTAGCAGGCCTGTTAC TGG Intergenic
No off target data available for this crispr