ID: 986149311

View in Genome Browser
Species Human (GRCh38)
Location 5:5112366-5112388
Sequence CATAATAATTAAGGGGAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986149311_986149316 5 Left 986149311 5:5112366-5112388 CCAGACTCCCCTTAATTATTATG No data
Right 986149316 5:5112394-5112416 ATAATTATTATACATATTTATGG 0: 3
1: 95
2: 646
3: 1761
4: 4016

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986149311 Original CRISPR CATAATAATTAAGGGGAGTC TGG (reversed) Intergenic
No off target data available for this crispr