ID: 986149948

View in Genome Browser
Species Human (GRCh38)
Location 5:5119524-5119546
Sequence GTGGAATTCAGAATCTAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986149948_986149956 25 Left 986149948 5:5119524-5119546 CCCACTTAGATTCTGAATTCCAC No data
Right 986149956 5:5119572-5119594 TCGTTAACAACCTTCCCTGGGGG No data
986149948_986149954 23 Left 986149948 5:5119524-5119546 CCCACTTAGATTCTGAATTCCAC No data
Right 986149954 5:5119570-5119592 TCTCGTTAACAACCTTCCCTGGG No data
986149948_986149953 22 Left 986149948 5:5119524-5119546 CCCACTTAGATTCTGAATTCCAC No data
Right 986149953 5:5119569-5119591 ATCTCGTTAACAACCTTCCCTGG No data
986149948_986149955 24 Left 986149948 5:5119524-5119546 CCCACTTAGATTCTGAATTCCAC No data
Right 986149955 5:5119571-5119593 CTCGTTAACAACCTTCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986149948 Original CRISPR GTGGAATTCAGAATCTAAGT GGG (reversed) Intergenic
No off target data available for this crispr