ID: 986152545

View in Genome Browser
Species Human (GRCh38)
Location 5:5140469-5140491
Sequence TGAAGCCCCGCGCGCGCGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 41}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986152541_986152545 -4 Left 986152541 5:5140450-5140472 CCCTCGGAGCGCTCCTGGATGAA 0: 1
1: 0
2: 0
3: 2
4: 56
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152533_986152545 14 Left 986152533 5:5140432-5140454 CCTCCGGTGGCCCCTAGCCCCTC 0: 1
1: 0
2: 0
3: 17
4: 177
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152538_986152545 2 Left 986152538 5:5140444-5140466 CCTAGCCCCTCGGAGCGCTCCTG 0: 1
1: 0
2: 2
3: 27
4: 254
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152537_986152545 3 Left 986152537 5:5140443-5140465 CCCTAGCCCCTCGGAGCGCTCCT 0: 1
1: 0
2: 0
3: 12
4: 85
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152532_986152545 15 Left 986152532 5:5140431-5140453 CCCTCCGGTGGCCCCTAGCCCCT 0: 1
1: 0
2: 5
3: 12
4: 208
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152531_986152545 22 Left 986152531 5:5140424-5140446 CCGGGGACCCTCCGGTGGCCCCT 0: 1
1: 0
2: 1
3: 29
4: 277
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152536_986152545 4 Left 986152536 5:5140442-5140464 CCCCTAGCCCCTCGGAGCGCTCC 0: 1
1: 0
2: 0
3: 5
4: 103
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152542_986152545 -5 Left 986152542 5:5140451-5140473 CCTCGGAGCGCTCCTGGATGAAG 0: 1
1: 0
2: 0
3: 5
4: 78
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152540_986152545 -3 Left 986152540 5:5140449-5140471 CCCCTCGGAGCGCTCCTGGATGA 0: 1
1: 0
2: 1
3: 20
4: 204
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152530_986152545 26 Left 986152530 5:5140420-5140442 CCGGCCGGGGACCCTCCGGTGGC 0: 1
1: 0
2: 2
3: 15
4: 140
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41
986152535_986152545 11 Left 986152535 5:5140435-5140457 CCGGTGGCCCCTAGCCCCTCGGA 0: 1
1: 0
2: 0
3: 17
4: 134
Right 986152545 5:5140469-5140491 TGAAGCCCCGCGCGCGCGGATGG 0: 1
1: 0
2: 0
3: 3
4: 41

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986152545 Original CRISPR TGAAGCCCCGCGCGCGCGGA TGG Exonic