ID: 986152678

View in Genome Browser
Species Human (GRCh38)
Location 5:5141329-5141351
Sequence CAGGATATGAACGTTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986152678_986152683 -2 Left 986152678 5:5141329-5141351 CCATCAGCAACGTTCATATCCTG 0: 1
1: 0
2: 0
3: 7
4: 113
Right 986152683 5:5141350-5141372 TGGGCCACAATTTGACATGAGGG No data
986152678_986152682 -3 Left 986152678 5:5141329-5141351 CCATCAGCAACGTTCATATCCTG 0: 1
1: 0
2: 0
3: 7
4: 113
Right 986152682 5:5141349-5141371 CTGGGCCACAATTTGACATGAGG 0: 1
1: 0
2: 0
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986152678 Original CRISPR CAGGATATGAACGTTGCTGA TGG (reversed) Intronic
901049065 1:6417227-6417249 CAGGATATGAAGGAAGCTGTAGG - Exonic
902403311 1:16169825-16169847 CAGGAGATGAAGGTTGCAGTGGG - Intergenic
906958219 1:50395300-50395322 CAGGAGATGAATGGTGGTGATGG - Intergenic
909336493 1:74480730-74480752 CAGGCTGTGAAGCTTGCTGAAGG + Exonic
910434635 1:87192889-87192911 CAGGATTTTTACATTGCTGAAGG - Intergenic
911002123 1:93177501-93177523 CGGGAGATGAAGGTTGCTGTGGG + Intronic
912095070 1:106129719-106129741 CAGGAAAGGAACATTGATGAGGG - Intergenic
914881625 1:151551466-151551488 CAGGATATGTAGGTTGCAGTAGG + Intronic
916899703 1:169207454-169207476 CAGGATAAGAACCTTGCTCTAGG + Intronic
920400314 1:205672081-205672103 CAGGATATGAAAGTTCCTGGCGG + Intronic
923070973 1:230564134-230564156 CAGGAGATGAATGGTGGTGAGGG + Intergenic
923761521 1:236849543-236849565 CAATAAATGAAAGTTGCTGAGGG + Intronic
924369245 1:243330277-243330299 CAGGTAATGAACCTTGATGACGG - Intronic
1065778911 10:29148371-29148393 AAGGACATGAATGATGCTGACGG - Intergenic
1067800732 10:49357182-49357204 CTGGAGATGAATGTTGTTGATGG + Intergenic
1068611910 10:59069626-59069648 GAGGATGGGAAAGTTGCTGATGG - Intergenic
1074242930 10:111657073-111657095 CAGGATATGTACCCTCCTGATGG + Intergenic
1077262648 11:1631027-1631049 CATGACATGAAAGATGCTGAGGG - Intergenic
1079551957 11:21710804-21710826 CAGCATATGAATTTTGGTGAGGG + Intergenic
1081384079 11:42450064-42450086 GAGGAAATTAAGGTTGCTGATGG + Intergenic
1081963897 11:47157842-47157864 CAGTCTCTGAACATTGCTGAGGG - Exonic
1086750541 11:90488562-90488584 CAGGATATGAACCTGGCAGTTGG - Intergenic
1090238079 11:125164353-125164375 CAAGATATCACCGGTGCTGAGGG - Intergenic
1091719105 12:2799666-2799688 AAGGGTATGAAGGATGCTGAGGG + Intronic
1091897167 12:4114923-4114945 CTGGAGATGAACGGTGGTGATGG - Intergenic
1097764093 12:63503754-63503776 CAGGATAACAACTATGCTGAGGG - Intergenic
1104259355 12:127168411-127168433 CAGTTTTTGAACTTTGCTGAAGG + Intergenic
1104894477 12:132155062-132155084 CAGGAAATGAACGCGGCTGCCGG + Intergenic
1105026916 12:132855166-132855188 CAGGAGATGAATGTTGCAGTGGG + Intronic
1105299357 13:19118529-19118551 CAGTATATGAATGCTGCTGAAGG + Intergenic
1107829374 13:44360699-44360721 CTGGAGATGAATGTTGGTGATGG + Intergenic
1109082912 13:57929996-57930018 CAACATATGAACTTTGCTCAAGG + Intergenic
1111770587 13:92591098-92591120 CAGCATATAAAGGTTGATGAAGG - Intronic
1111995529 13:95162622-95162644 CAGGAGATGAGCAGTGCTGAAGG + Intronic
1112421654 13:99256537-99256559 GAGGATATGAAAGTTACTAACGG - Intronic
1114051011 14:18919827-18919849 CAGTATATGAATGATCCTGAAGG - Intergenic
1114111547 14:19482095-19482117 CAGTATATGAATGATCCTGAAGG + Intergenic
1114154168 14:20080934-20080956 CACAATATGAATGTAGCTGAAGG + Intergenic
1114456272 14:22855886-22855908 CAGGATATATAACTTGCTGAAGG - Intergenic
1115383465 14:32767714-32767736 CAGGCTGTGAAAGTTGCTGAAGG - Intronic
1118747656 14:68785692-68785714 AAGGATAGGAACTATGCTGAGGG - Intergenic
1118856621 14:69628338-69628360 TAGAATTTGAAGGTTGCTGATGG + Intronic
1121842981 14:97150183-97150205 CAGGCTATGCTCGTTGCTGGGGG - Intergenic
1122935631 14:104954780-104954802 CAGGACACGGATGTTGCTGATGG - Exonic
1125750969 15:42028233-42028255 GAGGATAAGAACCTTGCTCAAGG + Intronic
1132148551 15:99443359-99443381 CAGGATATAAGGATTGCTGAGGG - Intergenic
1133061881 16:3180187-3180209 CAGGCTATGATTGTTGCTTAGGG + Intergenic
1136281201 16:29212422-29212444 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1138460426 16:57144430-57144452 CTGGATATGAAGGTGGCTAAGGG + Intronic
1141172243 16:81698689-81698711 CTGGAGATGAACGGTGGTGATGG - Intronic
1142085565 16:88178345-88178367 CAGGCTATGAACGGGGCTGCAGG + Intergenic
1146611556 17:34309939-34309961 CAGGAGATGGAGGTTGCTGAGGG - Intergenic
1148439029 17:47702338-47702360 CAGGATATGAAGGCTGAAGAGGG + Intronic
1155883481 18:31179182-31179204 CAGGATATCAGCTGTGCTGAAGG - Intergenic
1156701837 18:39835201-39835223 CAGGACATAAAGGTTGCTGGTGG + Intergenic
1157072470 18:44424012-44424034 CAGGAGATGAAACTTGCTGAAGG + Intergenic
1158667041 18:59441601-59441623 CAGCATGTGAACGGTGCTGTTGG + Intronic
927306535 2:21580020-21580042 TAGCATTTGAACTTTGCTGATGG + Intergenic
927521961 2:23704259-23704281 GAGGACATGAACGATCCTGATGG + Intronic
929463003 2:42118362-42118384 AAGGATTTGAAAGTGGCTGAAGG - Intergenic
934102343 2:88665097-88665119 CAGGATATGAAGTTTGGAGAGGG + Intergenic
940305638 2:152223163-152223185 CAGGATATGATCATTGTTCAAGG - Intergenic
942049261 2:172123607-172123629 CAGGACTTGAAAGTTGCTCAGGG - Intergenic
943640111 2:190348474-190348496 CTGGACATGAACAGTGCTGATGG - Intronic
944029162 2:195212951-195212973 CAAGATATGAATGTTTCTGTGGG + Intergenic
945921133 2:215755636-215755658 CAGGACAAGCAGGTTGCTGAGGG + Intergenic
948137978 2:235651342-235651364 CATGTTAAGAACATTGCTGATGG - Intronic
1172311797 20:33924114-33924136 CAGGATATAAGCGGTGCTGTGGG + Intergenic
1173448589 20:43142351-43142373 CAGGATTTGAAAGTTGAAGATGG + Intronic
1174482575 20:50841890-50841912 CAGGATACTCACGTTCCTGAAGG - Exonic
1175063810 20:56268165-56268187 CAGGAGATGAAGGTTGCAGTGGG - Intergenic
1175830123 20:61959760-61959782 CAGGATATGAGGGTTCCTGTTGG - Intronic
1180469489 22:15642202-15642224 CAGTATATGAATGATCCTGAAGG - Intergenic
1181345648 22:22218696-22218718 CAGGACATGTACATTTCTGATGG - Intergenic
1182275618 22:29186739-29186761 CAGGAGATGGATGTTGGTGATGG + Intergenic
1184310001 22:43635091-43635113 CAGGATTTGAAGGTAGCTAATGG - Exonic
956525366 3:70153779-70153801 CTGGAGAGGAACGTTGGTGATGG - Intergenic
961345704 3:126261992-126262014 CAAGACATGGACATTGCTGAGGG - Intergenic
962051498 3:131820422-131820444 AAGGACATGATCGTTGGTGAGGG + Intronic
963487617 3:145955472-145955494 CAGGATTTGAACCTTGCAAATGG - Intergenic
966775861 3:183542082-183542104 GAGGATGTGAATGTTGCTGGAGG + Intronic
967579136 3:191131502-191131524 CCGGAGATGAGCATTGCTGATGG + Intergenic
973903066 4:55497437-55497459 CAGGATATGAACCTCTCTGAAGG + Intronic
986152678 5:5141329-5141351 CAGGATATGAACGTTGCTGATGG - Intronic
986381133 5:7187205-7187227 AAGGATATGAACTTTGCAAATGG - Intergenic
987097158 5:14560265-14560287 TAGGATAAGAGCGTTGCTGATGG - Intergenic
991251031 5:64561479-64561501 GAGGTTGTGAAAGTTGCTGAAGG - Intronic
998420485 5:141980632-141980654 CAGGATATGAAATGTTCTGAAGG + Intronic
1001980914 5:176036592-176036614 CAGTATATAAATGGTGCTGAAGG + Intergenic
1002285938 5:178162756-178162778 CAGGATCTGAACGCTGCTCCCGG + Intergenic
1008790583 6:55226922-55226944 CAGGATATGAAGATTAGTGAAGG + Intronic
1010285401 6:74071804-74071826 CAGCATATGAATGTTCCTGTTGG - Intergenic
1010832691 6:80550771-80550793 CAGGTTATGAACAGTACTGAAGG - Intergenic
1014686231 6:124504983-124505005 CAGGATGAGACTGTTGCTGAAGG + Intronic
1015983574 6:138863570-138863592 CAGGGTATGAACGCTGTTGCTGG + Intronic
1022894627 7:34737545-34737567 TAGAATATGAAAGTTACTGAAGG - Intronic
1024601328 7:50984250-50984272 CAAGATTTGAACATCGCTGATGG + Intergenic
1027628084 7:80568502-80568524 AAGGAGATAAACGTTACTGAGGG + Intronic
1028411379 7:90533965-90533987 CAAGATATGAATGTTTATGAAGG - Intronic
1030566568 7:111164994-111165016 CTGGATATGAATGGTGGTGATGG - Intronic
1031757622 7:125665692-125665714 CCGTATATGAACGTTGGTGCGGG - Intergenic
1037527222 8:19738540-19738562 CAGGAGATGAACATTCGTGATGG + Intronic
1037563862 8:20099617-20099639 CAAGAAATGAAGGTTACTGAGGG - Intergenic
1037851341 8:22331925-22331947 CAACATATGAATGTTGCGGAGGG + Intronic
1041186886 8:55310312-55310334 AAGGATAAGGACTTTGCTGAAGG - Intronic
1042809094 8:72804394-72804416 CAGGATATGAAAACTGCTAATGG + Intronic
1045631803 8:104133114-104133136 AAGGTTATGAAGTTTGCTGAAGG - Intronic
1046288358 8:112125741-112125763 CAGTCCATGAACGTTCCTGATGG - Intergenic
1048228106 8:132610112-132610134 CTGGATATGAGGGTTCCTGAAGG - Intronic
1050019677 9:1269932-1269954 CAAGAAATGAAGGTTGATGAGGG + Intergenic
1052433146 9:28392949-28392971 AAGGCTATGAATGGTGCTGAGGG + Intronic
1055531302 9:77186793-77186815 CAGGAGATGAATGGTGGTGATGG - Intronic
1057927774 9:99168273-99168295 CAGGATGGGAACGTGGCTGTTGG - Intergenic
1058839376 9:108891385-108891407 CAGGATATCAGCATTGCTTATGG - Exonic
1187551202 X:20307251-20307273 CAGGATTTGAACTGTGATGATGG + Intergenic
1188124710 X:26352835-26352857 AAAGATCTGAAAGTTGCTGAAGG - Intergenic
1188232221 X:27678743-27678765 CTGGAGATGGATGTTGCTGATGG + Intronic
1189941940 X:46133464-46133486 CAGGATATGAACCTATCTTATGG - Intergenic
1195752569 X:108173125-108173147 CAAGAAAAGAACTTTGCTGATGG - Intronic
1199122859 X:144077558-144077580 CAGGATATATATGTTGATGATGG - Intergenic
1199494974 X:148442584-148442606 CAGGAAATGAACTTGGCTCAGGG + Intergenic