ID: 986154199

View in Genome Browser
Species Human (GRCh38)
Location 5:5157517-5157539
Sequence TAGTGACATGATGCATCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 126}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986154197_986154199 22 Left 986154197 5:5157472-5157494 CCTTTAGTTTAAATATGGTAATA 0: 1
1: 0
2: 1
3: 25
4: 335
Right 986154199 5:5157517-5157539 TAGTGACATGATGCATCTGGTGG 0: 1
1: 0
2: 1
3: 23
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986154199 Original CRISPR TAGTGACATGATGCATCTGG TGG Intronic
900796254 1:4710358-4710380 GAGTGTAAAGATGCATCTGGGGG - Intronic
905178835 1:36154745-36154767 TAGTGCCATGAGGTATCTTGGGG - Intronic
905250440 1:36644804-36644826 TTGTGAGATGATGAATCTGTCGG - Intergenic
905443812 1:38011714-38011736 TAGTGGCATGGGGCCTCTGGGGG + Intronic
906406559 1:45547006-45547028 TAGTGACTTGATGCAGATGGAGG - Intergenic
915083317 1:153366898-153366920 ATGTGATATGATGTATCTGGAGG + Intergenic
916281556 1:163057173-163057195 GAGTGACATGAAGCCTCTGGAGG - Intergenic
918779946 1:188686783-188686805 AAGTGACAAGCTGCATCTGGTGG - Intergenic
921979367 1:221238989-221239011 TACTAATATGATGCATTTGGAGG + Intergenic
1064681228 10:17812515-17812537 TACTGACTTGATGCCCCTGGGGG + Intronic
1068377767 10:56206984-56207006 TAGCAACAGGATGCAGCTGGAGG - Intergenic
1068871371 10:61948815-61948837 TAATGTCATGTTGTATCTGGAGG - Intronic
1078440236 11:11359023-11359045 CTGTGAGATGTTGCATCTGGTGG + Intronic
1080566655 11:33515808-33515830 AAGTAACGTGATGCATCTGTTGG + Intergenic
1081409111 11:42734876-42734898 CAGGGACATGATGGAGCTGGAGG + Intergenic
1084365046 11:68692372-68692394 TAGTGACGTCATCCACCTGGTGG + Intergenic
1087367714 11:97242255-97242277 TAGCAACATGATGAAACTGGAGG - Intergenic
1088842573 11:113639218-113639240 TACAGACATGAGGCATCTGCAGG + Intergenic
1090471160 11:126982385-126982407 TGGAGTCTTGATGCATCTGGTGG + Intronic
1092124941 12:6068410-6068432 TGGTGACAATTTGCATCTGGTGG - Intronic
1092627332 12:10340750-10340772 CAGGGACATGATGGAGCTGGAGG - Intergenic
1093829100 12:23733835-23733857 ATGTGACATCATCCATCTGGAGG - Intronic
1095631868 12:44386139-44386161 TAGTGAGAGGCTACATCTGGAGG - Intronic
1097218964 12:57435597-57435619 TACTCAAATGAGGCATCTGGAGG - Intronic
1100116211 12:91307920-91307942 TAGTCACATGCTGAATCTGCTGG - Intergenic
1105235585 13:18549376-18549398 TAGGGACATTATGGAGCTGGAGG - Intergenic
1106122669 13:26873568-26873590 TAGTGGGATGATTCATCCGGCGG - Intergenic
1108578578 13:51809951-51809973 TAGGCACATGATGCACCTGAGGG - Intergenic
1108787243 13:53919738-53919760 TAGTGCCATGATAAATATGGGGG + Intergenic
1110191954 13:72740317-72740339 TAAAGACATGAGGCTTCTGGGGG - Intronic
1112299027 13:98213496-98213518 CAGTGACATGAGGCGGCTGGAGG + Intronic
1116696563 14:48184511-48184533 TAGAGACATGATGCTTTTGGAGG + Intergenic
1116992471 14:51290919-51290941 AAGTGACAAGCTACATCTGGTGG - Intergenic
1117169078 14:53072120-53072142 AAGTGACAGAATGCATTTGGTGG + Intronic
1117492396 14:56262927-56262949 TAGTGACCTGTTTTATCTGGGGG + Intronic
1120141074 14:80930270-80930292 AAGTGACAAGCTGCATCTGGCGG + Intronic
1120272767 14:82335627-82335649 TAGCAACATGATGGAACTGGAGG + Intergenic
1120992483 14:90390070-90390092 GAGTGACATGATGAAACTGCTGG + Intergenic
1122743840 14:103886804-103886826 GTGTGACAGAATGCATCTGGGGG + Intergenic
1126868747 15:52964704-52964726 TAGTGACATGATTCCTATGAAGG + Intergenic
1133043808 16:3075080-3075102 TTGTCACACCATGCATCTGGGGG - Intronic
1135992948 16:27228725-27228747 GAGTACCATGATGGATCTGGAGG - Intronic
1135992964 16:27228781-27228803 GGGTGCCATGATGGATCTGGAGG - Intronic
1135992984 16:27228837-27228859 GGGTACCATGATGCATCTGGAGG - Intronic
1137028418 16:35500623-35500645 TAGTGACAGGATGGATTGGGAGG + Intergenic
1137852168 16:51756574-51756596 TAGTGGCCTGATAAATCTGGAGG - Intergenic
1138425649 16:56930621-56930643 AAGTGACAAGCTGCATCTGGTGG - Intergenic
1142410750 16:89915418-89915440 TCGTGCCAAGATGCAGCTGGAGG - Intronic
1144311483 17:14018029-14018051 GAGTGAGATGATGTATGTGGAGG + Intergenic
1150289799 17:63974563-63974585 TAGTGACAAGCAGCATGTGGGGG - Intergenic
1153479188 18:5530007-5530029 TAGTGACATGTTGGGTATGGTGG - Intronic
1154513954 18:15140623-15140645 TAGGGACATTATGGAGCTGGAGG + Intergenic
1156340599 18:36206780-36206802 CAGCAACATGATGCAGCTGGAGG - Intronic
1156694309 18:39748572-39748594 TAATGAAATAGTGCATCTGGTGG + Intergenic
1160817570 19:1043190-1043212 TAGTGACCTGATGGAGCTGGTGG + Exonic
1161981706 19:7633442-7633464 CAGGGACATGATGGATCAGGAGG - Exonic
1167088893 19:47329777-47329799 TAGTGAGATGCTGTCTCTGGGGG - Intergenic
930880481 2:56264644-56264666 TAATGACAGGATGACTCTGGTGG - Intronic
931714043 2:65014522-65014544 TAGTGGCATCATGCAGGTGGGGG - Intronic
933781710 2:85807142-85807164 TAGGGACAGGATTGATCTGGGGG + Intergenic
934471460 2:94544374-94544396 GAGTGATTTGATGCATGTGGTGG - Intergenic
935655872 2:105422313-105422335 TGGTGGCAAGATGCATATGGAGG + Intronic
937512029 2:122606803-122606825 TAGTTATATGAATCATCTGGGGG - Intergenic
938514192 2:131985231-131985253 TAGGGACATTATGGAGCTGGAGG + Intergenic
939306386 2:140416681-140416703 AAGTAACAAGCTGCATCTGGTGG + Intronic
939859677 2:147403272-147403294 CAGTAACAGGATGCACCTGGAGG - Intergenic
940479455 2:154210132-154210154 TTGTGACAACATGAATCTGGAGG - Intronic
942635683 2:178002210-178002232 CAGCAACATGATGCAGCTGGAGG - Intronic
944360818 2:198854124-198854146 CAGTAACATGATGGAGCTGGAGG + Intergenic
947502344 2:230680604-230680626 TGGTGACATGATGCAGCTCCTGG - Intergenic
948238064 2:236405173-236405195 AAGTGACTTCATGCTTCTGGAGG + Intronic
1171057619 20:21922744-21922766 TAGGAACATGATGGAGCTGGAGG - Intergenic
1172193947 20:33079343-33079365 TAGAAACTAGATGCATCTGGGGG + Intergenic
1173361716 20:42350550-42350572 CAGTCACATGATTCAACTGGAGG + Intronic
1173411489 20:42814658-42814680 TAGTGCCATGTTTCATCAGGAGG + Intronic
1174278947 20:49424612-49424634 TAGGGACAGGCAGCATCTGGGGG - Intronic
1176779587 21:13177661-13177683 TAGGGACATTATGGAGCTGGAGG - Intergenic
1177561344 21:22758467-22758489 TAGTGTCATTAAGCAACTGGAGG - Intergenic
1177977220 21:27866702-27866724 TAGGGACATTATGGAGCTGGAGG - Intergenic
1182974284 22:34608123-34608145 AAGTGACAAGTTGCATCTGGTGG + Intergenic
949947689 3:9203210-9203232 TAGTGACAAGCTGCAGCTGCAGG - Intronic
951702445 3:25509917-25509939 AAGGGACATGACGGATCTGGAGG - Intronic
952005576 3:28838734-28838756 AAGTGACATGATGAAAATGGTGG + Intergenic
953013496 3:39051420-39051442 TAGGGACATGATGGAGCTGGAGG - Intergenic
957883304 3:86249852-86249874 TTGAGACATGAAGGATCTGGTGG - Intergenic
959653775 3:108778158-108778180 AAGTGATATGATGCATTTGCAGG - Intergenic
959793982 3:110399935-110399957 AAGTGACAAGATGGATCTGAAGG - Intergenic
959799186 3:110470709-110470731 TAGTTACATGATGCATGTTTGGG + Intergenic
960147037 3:114214500-114214522 AAGTTACAAGATGCTTCTGGGGG + Intergenic
962482565 3:135810339-135810361 TAGTCACATGAAAGATCTGGAGG + Intergenic
966315765 3:178644043-178644065 TAGTGACATGGTGGAACTGGGGG - Intronic
971627563 4:28942116-28942138 GAGTGACCTCTTGCATCTGGTGG + Intergenic
971863391 4:32138168-32138190 AAGTGACAAGTTGCCTCTGGTGG + Intergenic
972128276 4:35798316-35798338 AAGCCACATGATGCATCTGGAGG + Intergenic
972151179 4:36093053-36093075 CAGGGACATGATGGAGCTGGAGG + Intronic
972934875 4:44121709-44121731 CAGTGACATGATTCAACTGGAGG - Intergenic
973809699 4:54557865-54557887 TATTGACATGGTGCATCTGCAGG + Intergenic
976367124 4:84244694-84244716 TCTTGACATGACGCATCAGGTGG - Intergenic
976449906 4:85176774-85176796 TACTTTCATGATGCATCTTGAGG + Intergenic
978316119 4:107439378-107439400 AAGTGACAAGCTGCATCTGGTGG - Intergenic
979046492 4:115873027-115873049 TAGTGACATATTGTATGTGGGGG + Intergenic
979623448 4:122821229-122821251 AAGGGACAAGCTGCATCTGGTGG - Intergenic
981645621 4:146995561-146995583 CAGTAACATGATGTAGCTGGAGG + Intergenic
985685856 5:1281086-1281108 TAGTGACAAGGAGCATCTTGGGG + Intronic
986154199 5:5157517-5157539 TAGTGACATGATGCATCTGGTGG + Intronic
988135950 5:27172122-27172144 AAGTGACAAGCTGCAGCTGGTGG + Intergenic
989881438 5:46792065-46792087 TAGTGACTTGGGGCCTCTGGTGG + Intergenic
990459969 5:56022282-56022304 TAGTGAGATGATAGATTTGGGGG + Intergenic
993877005 5:93319134-93319156 TAGTGGCATTATCCATCTTGGGG - Intergenic
997823934 5:137089703-137089725 TCATGAGATGATGCATCTGATGG - Intronic
998672867 5:144373280-144373302 TAGTGATATGATGCAAATGAAGG + Intronic
999147781 5:149407134-149407156 TAGGGGGATGCTGCATCTGGGGG + Intergenic
1000952970 5:167507586-167507608 AAGTGACATCATGCAAATGGTGG + Intronic
1007291461 6:40790311-40790333 TAGGGACATCATGCCTTTGGAGG + Intergenic
1007635810 6:43299103-43299125 TATTTACATAATCCATCTGGAGG + Intronic
1009288968 6:61860513-61860535 CAGGGACATGATGCAGCTGGAGG - Intronic
1009934093 6:70212819-70212841 TAGTGAGATGATCACTCTGGGGG - Intergenic
1010928503 6:81772368-81772390 TATTGACATCATGCTTCTGGGGG + Intergenic
1012614389 6:101258701-101258723 CAGTGACAAGCTGCATCTGGTGG + Intergenic
1013676155 6:112465220-112465242 TAGTCACTTGATGCTTCTGGGGG + Intergenic
1014372766 6:120633089-120633111 CAGGGACATGATGGAGCTGGAGG + Intergenic
1015669386 6:135671595-135671617 CAATGACATGATGAACCTGGAGG + Intergenic
1019544707 7:1568369-1568391 TAAGGACATGGGGCATCTGGCGG - Intronic
1020917256 7:14210214-14210236 TATTTATATGATACATCTGGTGG + Intronic
1026701504 7:72650354-72650376 TAGTGACAAGATGTGCCTGGGGG + Intronic
1030721323 7:112874386-112874408 CAGCAACATGATGCAGCTGGAGG + Intronic
1031208171 7:118789084-118789106 GACTTACATGATGCATCTGTGGG + Intergenic
1033443896 7:141403842-141403864 TAGTGAAGTGATGCATTTTGAGG - Intronic
1033871145 7:145754187-145754209 TACTGATAAAATGCATCTGGAGG + Intergenic
1034273680 7:149815011-149815033 TAGTGACATGATGTGTGTGGAGG - Intergenic
1035073979 7:156166173-156166195 TTGTGACATCATGGACCTGGAGG + Intergenic
1035531474 8:355238-355260 TAGTCAAATGAGGCATCTGGAGG - Intergenic
1036382576 8:8246908-8246930 AAGTGACAACCTGCATCTGGTGG + Intergenic
1037190365 8:16117462-16117484 AAGTGACAAGCTGCATCTGATGG + Intronic
1042818441 8:72903759-72903781 TATTGACATGATGAAAATGGAGG - Intronic
1044031915 8:87249007-87249029 AAGTGACAAGCTGCATCTGGTGG - Intronic
1045840942 8:106579952-106579974 TAGTGATTTTATGCAGCTGGCGG - Intronic
1045885852 8:107097218-107097240 CAGGGACATGATGGAGCTGGAGG + Intergenic
1048526080 8:135204286-135204308 CAGCAACATGATGCAGCTGGAGG + Intergenic
1048712285 8:137225756-137225778 TAGTCACATGCTGCATATGATGG + Intergenic
1054983232 9:71231628-71231650 CAGCAACATGATGCAGCTGGAGG + Intronic
1055887157 9:81077094-81077116 TTGTGACATGATACATTTGCTGG - Intergenic
1057306918 9:93917919-93917941 TAGGGACATGTTGCATCTGGCGG + Intergenic
1057775613 9:98006246-98006268 AAGTGACAAGCTGCATCTGGTGG + Intronic
1058573573 9:106375044-106375066 TAGGGAGATTATGCATGTGGAGG - Intergenic
1186256385 X:7725613-7725635 TAGGTAAATGATGCATCAGGGGG - Intergenic
1186738253 X:12489626-12489648 CTATGACATGATGCATTTGGTGG + Intronic
1189086760 X:38033264-38033286 TGGCGACGTGATGCAGCTGGCGG + Intronic
1195728596 X:107942245-107942267 TAGGAACATGATGCAGCTGGAGG + Intergenic
1198721255 X:139623424-139623446 CAGCAACATGATGCAGCTGGAGG + Intronic
1200887188 Y:8281480-8281502 TAGCTACATGATGGATCTGCAGG + Intergenic