ID: 986157871

View in Genome Browser
Species Human (GRCh38)
Location 5:5194910-5194932
Sequence TCAGTTCTGTTTACATTCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986157871 Original CRISPR TCAGTTCTGTTTACATTCGG AGG Intronic
906947597 1:50308628-50308650 TCAGATCTGTTTTCACTAGGAGG - Intergenic
910424650 1:87108437-87108459 TTAGTGCTGTTTACTTTCAGAGG + Exonic
911792941 1:102041287-102041309 TCAGTACTGTTGACATTTGAAGG + Intergenic
912333385 1:108840671-108840693 ACAGTTCTGTATACATGTGGAGG + Intronic
916344035 1:163768249-163768271 TCAAATCTGTTTCCATTCAGAGG - Intergenic
918809930 1:189103340-189103362 TCATTTCTGATTACATTTGTTGG - Intergenic
918882913 1:190149352-190149374 TCATTCCTGTTTACTTTCTGCGG + Intronic
919388527 1:196952750-196952772 TAAGTTCTGGTTCCATTCAGTGG + Intronic
922140598 1:222881599-222881621 TCAGTTCTCTTTACATTGTGAGG + Intronic
1070650653 10:78233170-78233192 TCTGTTCTGTTGGCATTCTGAGG - Intergenic
1074098289 10:110332492-110332514 TCAGATCTGTTTTCATGCTGTGG + Intergenic
1080433038 11:32216012-32216034 GCAGTGCTGTTGACATTTGGGGG - Intergenic
1081227471 11:40541882-40541904 TCAGTTCTGTTTATAGAAGGAGG - Intronic
1081574635 11:44311284-44311306 GCAGTTCGTTTTACAGTCGGGGG - Intergenic
1083818658 11:65152882-65152904 TAAGTCCAGTTTACATTCGCGGG - Intergenic
1084142623 11:67243229-67243251 TCAGTTCTGTTTTGACTCGTAGG + Intronic
1089660505 11:119982368-119982390 ACAGTTCTGCTTACTTTAGGAGG + Intergenic
1092073602 12:5654456-5654478 TCAGTTCTGTGTACTGTCTGAGG + Intronic
1093490993 12:19704041-19704063 TCATTTCTGATTGCATTTGGTGG - Intronic
1102971141 12:117167796-117167818 TCAGTTCTGCTGACATGCTGAGG + Intronic
1105534097 13:21248005-21248027 TCAGTTCTGTTTTCATCCCAAGG - Intergenic
1108661856 13:52595149-52595171 TCAGTTCTGTCTGCAGTAGGAGG - Intergenic
1112928657 13:104708521-104708543 TCAGTTATGTTTACATACGCTGG - Intergenic
1119274225 14:73339026-73339048 TCATTTCTGTCTACATTTGCAGG + Intronic
1120998114 14:90432056-90432078 TCAGTTCTGTTTCGGTTCCGTGG + Intergenic
1121298549 14:92850530-92850552 TCAGGTATGTTTACATTCAGTGG + Intergenic
1121696636 14:95918646-95918668 TCAGCTGTGTTTACTTTCCGAGG - Intergenic
1123996312 15:25720192-25720214 TCAGTACTGTATACATTCATGGG + Intronic
1125227185 15:37408514-37408536 GCAGCTATGTTTACATTCTGAGG - Intergenic
1132266749 15:100480274-100480296 TCAGTTCTTTTCACATTTTGAGG - Intronic
1150047377 17:61927055-61927077 TCACTTTTGTTTACATTTTGTGG - Intronic
1155203972 18:23541459-23541481 TCACTTCTGTTTACAGCCGGGGG + Intronic
1157384620 18:47250683-47250705 TCAGTTCTCATTACATTTGGCGG + Intergenic
1161860310 19:6792912-6792934 TCAGCGCTGTTGACATTTGGTGG - Intronic
1162497795 19:11033134-11033156 CCAGCTCTGTTTTCATGCGGCGG + Intronic
1162822501 19:13231530-13231552 TCAGCACTGTTGACATTTGGGGG - Intronic
1167841820 19:52128213-52128235 TATGTTCTGTTTACATTTTGAGG + Intronic
927639491 2:24837809-24837831 TCAGGTCTGTAGATATTCGGGGG + Intronic
933215507 2:79625621-79625643 TCAGGTGTGTTTACATGCTGAGG + Intronic
933845782 2:86326107-86326129 CCAGTGCTGTTTCCATTGGGTGG - Intronic
934663693 2:96156290-96156312 TCTGTTCTGTTTCCACTGGGTGG - Intergenic
936086481 2:109473079-109473101 TCAGTTCTCTTTAGATTCTTGGG - Intronic
936540438 2:113345906-113345928 TCAGTTGTGTTTATATTAAGTGG + Intergenic
941589090 2:167396227-167396249 TCAGCTCTGTTTCCATTCAACGG - Intergenic
943823361 2:192356420-192356442 TAAGTTCAGTGTACATTCAGTGG - Intergenic
948609267 2:239156376-239156398 TCAGTTTAGTTTTCTTTCGGTGG - Intronic
1173219244 20:41117723-41117745 TCTGTTCTGGCTACATTGGGTGG + Intronic
1181927753 22:26374039-26374061 TCAGTTTTGTTTTCATTTTGTGG + Intronic
949242909 3:1892484-1892506 TCAGTTCAGTTTAGATTGTGTGG + Intergenic
951846561 3:27090824-27090846 TTAGTTCTGTTTGCATGCAGTGG + Intergenic
951905862 3:27706967-27706989 TCAGCTCTATTGACATTTGGAGG - Intergenic
952126466 3:30306329-30306351 TCAGTTCTGCTTAGATGCAGTGG + Intergenic
952841150 3:37646600-37646622 TTAGATCTGTTTACATTTGCTGG + Intronic
956459361 3:69455278-69455300 TCAGGTCTGTTTACATAATGTGG + Intronic
959837726 3:110940229-110940251 TCAGCTTTGTTTACTTTCTGAGG + Intergenic
965097084 3:164244160-164244182 TCAGTTCTGTGTATTTTCTGTGG - Intergenic
965750100 3:171966842-171966864 TCAATTCTGTTTCCATCCTGGGG - Intergenic
966144740 3:176797715-176797737 TCATTTCTGTTCACATTCTCTGG - Intergenic
966651061 3:182301595-182301617 TAAGCTCTGTTAACATTAGGAGG - Intergenic
966912805 3:184568905-184568927 TCATTTCTGTTTAATTTCTGGGG - Intronic
968681907 4:1926853-1926875 TCAGTTCTTTTTACATGCCTTGG + Intronic
970049789 4:11900806-11900828 TCAGTTAGGTTTACATTCAGTGG - Intergenic
972050377 4:34724859-34724881 TCAGTTCAGTTTATATTCTTTGG - Intergenic
976613409 4:87052437-87052459 TCATTTCTGTTTATTTTGGGTGG - Intronic
976691756 4:87875877-87875899 CCATTTCTGTTTACATTCCATGG - Intergenic
977411599 4:96672992-96673014 TGAATTCTGTTTCCATTCAGTGG - Intergenic
978367767 4:108000481-108000503 TCTGTTCTGTTCACATCCTGGGG + Intronic
980878900 4:138689518-138689540 TAAGTATTGTTTACATTCAGAGG - Intergenic
984591003 4:181617617-181617639 TCTGTTCTATTTACAATGGGAGG + Intergenic
986157871 5:5194910-5194932 TCAGTTCTGTTTACATTCGGAGG + Intronic
989665101 5:43845015-43845037 TCATTTCTGTTTATATTCCATGG + Intergenic
993692628 5:91021457-91021479 TCAGTTTTATTTATATTAGGTGG + Intronic
995968898 5:117942868-117942890 ACACTTCTGTTTTCATTCTGTGG - Intergenic
997900728 5:137761684-137761706 TCAATTATGGTTACATTTGGAGG - Intergenic
1009953494 6:70423625-70423647 TCACTTCAGTTTACATTCCATGG + Intronic
1012043425 6:94239041-94239063 TCAGTTTTGTTTACACTGTGAGG - Intergenic
1023202504 7:37713901-37713923 TCAGTTTTGTTTACATAATGGGG - Intronic
1024818865 7:53303654-53303676 TCAGATCTGTGAACATTTGGAGG + Intergenic
1025266476 7:57463126-57463148 TCATTTCTCTTTATATTCTGGGG - Exonic
1025742867 7:64214066-64214088 TCATTTCTCTTTATATTCTGGGG - Intronic
1026193788 7:68154309-68154331 TCAGTTATATTCACATTTGGGGG - Intergenic
1026456819 7:70580075-70580097 TCAGTGCTGGTTACGTTCGAAGG - Intronic
1034323050 7:150203504-150203526 TCAGTGCTATCTACATTCAGGGG - Intergenic
1034770130 7:153765603-153765625 TCAGTGCTATCTACATTCAGGGG + Intergenic
1037789823 8:21927880-21927902 TGAGTGCTGTTTACATTTGAGGG - Intronic
1039452045 8:37683009-37683031 ACTGTTCTGTTGACATTCTGAGG + Intergenic
1040684114 8:49850232-49850254 TCAGTTCTTTGTACATTTGGTGG - Intergenic
1042269460 8:66940875-66940897 TCAGTGCTGTTTACACTCAATGG + Intergenic
1043288326 8:78563423-78563445 TTAGTTCCATTTACATTCAGTGG - Intronic
1047975138 8:130122250-130122272 TCTGTCCTGCTTACATTCTGAGG - Intronic
1048799602 8:138183913-138183935 TGAGTTCTATTTATATTTGGAGG - Intronic
1051588564 9:18752432-18752454 AAAGTTCTGTTTACAGTCTGAGG - Intronic
1052489758 9:29150242-29150264 TCATTTCTGGGTACTTTCGGAGG - Intergenic
1186201206 X:7157026-7157048 TGAGCTCTGTATACATTCAGTGG - Intergenic
1186628822 X:11325951-11325973 TCAGCTCTATTGACATTTGGGGG - Intronic
1187251740 X:17605009-17605031 GCATGTCTGTTTACATTCTGAGG + Intronic
1188147288 X:26629878-26629900 TCATTTCTGGTTGCTTTCGGGGG + Intergenic
1193003637 X:76591204-76591226 CCAGTTTTGTTTACATTGTGAGG + Intergenic
1196840583 X:119855421-119855443 TCAGTTTTGGATGCATTCGGTGG - Intergenic
1198492919 X:137161512-137161534 TCACTTCTGTTTACGTCCAGTGG + Intergenic