ID: 986159111

View in Genome Browser
Species Human (GRCh38)
Location 5:5208336-5208358
Sequence AAGGGCCTATTGAAATTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 49, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986159111 Original CRISPR AAGGGCCTATTGAAATTTGT AGG Intronic
902986628 1:20158454-20158476 AAAGGCCCATTGAAATCTGGGGG + Intergenic
909004663 1:70261108-70261130 ATGGACCTATTGAATTTTGGGGG - Exonic
912617604 1:111120770-111120792 AATGTCCTATTGAAATCTCTGGG - Intronic
916696138 1:167238531-167238553 AGGGGCATTCTGAAATTTGTTGG - Intronic
917717159 1:177749730-177749752 AAAGGCCTATGGAAATGTCTTGG + Intergenic
918755721 1:188337839-188337861 AAGGGCCTCTAGAATTTTGGAGG - Intergenic
922279385 1:224108533-224108555 AAGGTCCTATTGTAGTCTGTTGG + Intergenic
923824559 1:237485639-237485661 AAGGCCCTCTTGAAACTTATAGG - Intronic
924147572 1:241091932-241091954 AAGGGCTCATTGAAATTATTTGG + Intronic
1063726379 10:8641955-8641977 AAGGACTGAATGAAATTTGTGGG + Intergenic
1064035672 10:11911609-11911631 AAGGGCACCTTGAATTTTGTTGG + Intergenic
1064397222 10:14991668-14991690 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1064400119 10:15014138-15014160 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1066390402 10:34973491-34973513 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1066477219 10:35759471-35759493 AAGGGCCTATTCAAATATGTGGG - Intergenic
1069215572 10:65814640-65814662 AAGGAACTATTGGAATTTGTGGG + Intergenic
1071140539 10:82504524-82504546 AAGGGCAAATTGATAATTGTGGG + Intronic
1074425386 10:113346848-113346870 AAGTGTCTATTGAAATCTATAGG + Intergenic
1077589034 11:3477521-3477543 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1077670382 11:4151868-4151890 AAGGGGCTCTTGCAATTTGAAGG + Intergenic
1077806841 11:5598932-5598954 AAGGGCATAAGGAAATTTGAAGG - Intronic
1079982327 11:27164471-27164493 AAGGGCTTTTTAATATTTGTTGG - Intergenic
1080329376 11:31117826-31117848 AAGGGCTTTTTGAAATTACTTGG - Intronic
1084227710 11:67727647-67727669 AAGGGCCTATTGAACTCCGGGGG - Intergenic
1084244729 11:67849144-67849166 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1084811532 11:71614761-71614783 AAGGGCCTATTGGACTCTGGGGG + Intergenic
1084827955 11:71745412-71745434 AAGAGCCTATTGAACTCTGGGGG + Intergenic
1084847464 11:71911683-71911705 AAGGGCCTATTGAACTCTGGGGG + Intronic
1085931513 11:81088884-81088906 AATGGCCTATTGAGATCTATAGG - Intergenic
1086046419 11:82537321-82537343 AAGGGCCTTATAAAATATGTGGG + Intergenic
1088866100 11:113849568-113849590 ATGGCCCTATGGAAATTTGAAGG + Intronic
1092415293 12:8286289-8286311 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1092432376 12:8419890-8419912 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1096786963 12:54022338-54022360 AAGGGGCAATTTAATTTTGTAGG - Intronic
1097332281 12:58344495-58344517 AAGGGCATAAGGCAATTTGTAGG + Intergenic
1097641297 12:62185537-62185559 AATGGCATACTCAAATTTGTTGG - Intronic
1098143779 12:67477622-67477644 GAAGGCCTATTGACATCTGTGGG + Intergenic
1099283965 12:80691914-80691936 CAGTGGCTATTGAAATATGTTGG - Intergenic
1101911875 12:108866157-108866179 CAGGGACTAGTGAATTTTGTGGG - Intronic
1105306749 13:19174275-19174297 AAGGGCTTAGTGACATTTGTGGG - Intronic
1107154365 13:37149253-37149275 AAGGGCCCATGGCAATTTGTTGG - Intergenic
1107167615 13:37300551-37300573 TAGGACATATTGAAACTTGTGGG + Intergenic
1107176260 13:37402658-37402680 AAGAACCTATTGATATGTGTAGG - Intergenic
1107355146 13:39558411-39558433 AATGTCCTATTGAACTTTGCTGG - Intronic
1107544157 13:41421456-41421478 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1108456566 13:50620853-50620875 AAGGGGCTCTTGTAAATTGTGGG + Intronic
1108959752 13:56210501-56210523 AAAGGCCTTTTGAAATTTTTTGG + Intergenic
1110239065 13:73246946-73246968 AAGGGCCTATAGAAGTATCTAGG + Intergenic
1112015388 13:95327202-95327224 AAGGGCCTGTGAAAATATGTGGG - Intergenic
1115237189 14:31218920-31218942 AAGGGCATATAGAAAATTTTAGG + Intergenic
1116266941 14:42704280-42704302 AAAGTCTTATTGAAATTTGTTGG + Intergenic
1117038795 14:51751683-51751705 AAGGGCCTATCGAACTCTGGGGG + Intergenic
1119417127 14:74479262-74479284 AAGGGTCTAGTGAAATTAGTGGG + Intronic
1121372513 14:93373128-93373150 AACAACTTATTGAAATTTGTGGG + Intronic
1121928778 14:97953050-97953072 AAGGGACCATGGAAATTTGATGG + Intronic
1126430907 15:48583302-48583324 AAGGGCAGCTTGAAATTTGTGGG + Intronic
1128127237 15:65202134-65202156 AAGGTGATATTGACATTTGTGGG - Intronic
1131417126 15:92270003-92270025 AAGAGCCTTTTGAAATCTGAGGG - Intergenic
1132379925 15:101359240-101359262 TAGGGCCTACTGGAATTTGGGGG - Intronic
1138635395 16:58333984-58334006 AAGGGCTATTTGAAAATTGTTGG - Intronic
1138698055 16:58834130-58834152 AAGGGGGTATTGAAATTTTGAGG - Intergenic
1138707944 16:58936982-58937004 AAGGGCCAATTGACATATGAAGG - Intergenic
1140874317 16:79136774-79136796 ATGTGCCTATTGAATTTTGTTGG - Intronic
1140883154 16:79217519-79217541 GAGGGCCTATTGAGAAATGTAGG - Intergenic
1203139932 16_KI270728v1_random:1756286-1756308 AAGAGAACATTGAAATTTGTGGG + Intergenic
1145864846 17:28234496-28234518 AAGCGCCTATTGAACTCTGGGGG - Intergenic
1153317117 18:3734646-3734668 AGGTGCCTATTCACATTTGTAGG - Intronic
1155391910 18:25347961-25347983 AAGGGCCTATTGCATTTTCATGG + Intronic
1157018688 18:43752287-43752309 AAGGACATATTGGAATTTCTTGG + Intergenic
1157319764 18:46624944-46624966 AATGGCCCATTGCAATTTCTCGG - Intronic
1158552205 18:58445861-58445883 AAGGATCTATTGAACTTAGTAGG + Intergenic
1163966372 19:20750816-20750838 AAGGGCCTATTGAACTCTGGGGG - Intronic
1164195438 19:22953447-22953469 GAGGGGCTGTTGAATTTTGTTGG - Intergenic
1164481054 19:28611268-28611290 AAAGGCCTATTGAACTCTGGGGG + Intergenic
1167717743 19:51154764-51154786 AAGAGCTTGGTGAAATTTGTGGG + Intergenic
925044265 2:759557-759579 AAGTGCTTATTGAAATTGATAGG - Intergenic
925576665 2:5367350-5367372 AAGGGCCCTGTGAAATTTGAAGG + Intergenic
927052514 2:19344713-19344735 AAGAGCCTAATGAATTTTGTGGG + Intergenic
931356286 2:61539533-61539555 AAGGGCCTAGTAAATTTTGGTGG - Intergenic
931766528 2:65461580-65461602 AACCGCCTATTGAAATTGTTAGG - Intergenic
932349946 2:71023607-71023629 AAGGGCCTATTGAACTCTGGGGG + Intergenic
932353441 2:71049745-71049767 AAGGGCCTACTGAACTCTGGGGG + Intergenic
934030211 2:88038292-88038314 AAGAGCCTAATGATATTTGCTGG + Intronic
935676459 2:105598541-105598563 AAGGGCCGTTTGTAATTTGCTGG + Intergenic
938787314 2:134642828-134642850 TAGAGCATATTAAAATTTGTGGG + Intronic
939750581 2:146040278-146040300 AAGGGCATATGGAAATTTTGTGG - Intergenic
940869526 2:158848384-158848406 AAGGGCCTATTGAACTCTGGGGG + Intronic
940872202 2:158869382-158869404 AAGGGCCTATTGAACTCTGGGGG + Intergenic
940874409 2:158885370-158885392 AAGGGCCTATTGAACTCTGGGGG + Intergenic
944638779 2:201700809-201700831 AATGCCCTATTGTAAGTTGTTGG - Exonic
947595003 2:231405528-231405550 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1169763695 20:9125714-9125736 ATAGCCCTATTGATATTTGTGGG + Intronic
1169796180 20:9465217-9465239 GAAGGCCTGTTGAATTTTGTTGG - Intronic
1171408547 20:24930246-24930268 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1179349706 21:40596441-40596463 AAGAGCTTATTGAATTTTGTGGG + Intronic
1181181178 22:21069661-21069683 AAGGGCTTAGTGAGGTTTGTGGG + Intergenic
1184790879 22:46699164-46699186 AAGGGCCTCATGAAATGTGCCGG - Intronic
951110569 3:18798681-18798703 TATGGCCTATTGATATTTGCTGG - Intergenic
953351890 3:42222194-42222216 AAAGGCCCACTGAAATGTGTGGG - Intronic
957022501 3:75140957-75140979 AAAGGCCTATTGAACTCTGGGGG + Intergenic
957044389 3:75362712-75362734 AAGGTCCTATTGAACTCTGGGGG - Intergenic
957076184 3:75604895-75604917 AAGGGCCTATTGAACTCTGGGGG - Intergenic
958506816 3:94989702-94989724 ATGTGCCTATTGAAAATTGGTGG - Intergenic
959020789 3:101185611-101185633 ATGGCTCTATGGAAATTTGTGGG + Intergenic
961272252 3:125698050-125698072 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961278032 3:125742910-125742932 AAGGGCCTACTGAACTCTGGGGG + Intergenic
961876382 3:130026746-130026768 AAGGGCCTACTGAACTCTGGGGG - Intergenic
961892843 3:130144903-130144925 AAGGGCCTAATGAACTCTGGGGG - Intergenic
963203500 3:142608739-142608761 AAGGCCCCACTGAAATTGGTTGG + Intronic
963551741 3:146732678-146732700 AAGGGCCAATTGAGAGTTCTGGG + Intergenic
964262189 3:154852026-154852048 AAGTGCCTATTATAAATTGTAGG + Intergenic
964376046 3:156050106-156050128 AAGGAACTATTGAAATGAGTGGG - Intronic
965869733 3:173251320-173251342 ATGGGGCTATTGAATTTAGTTGG + Intergenic
966370668 3:179248051-179248073 GAGGGGCTATTTAATTTTGTAGG - Intronic
969729477 4:8945570-8945592 AAGCGCCTATTGAACTCTGGGGG + Intergenic
969734217 4:8976213-8976235 AAGGGCCTCTTGAACTCTGGGGG + Intergenic
969785645 4:9455099-9455121 AAGGACCTATTGAACTCTGGGGG + Intergenic
969789067 4:9479509-9479531 AAGGGCCTATTGAACTCTGGGGG + Intergenic
969793804 4:9510277-9510299 AAGGGCCTATTGAACTCTGGGGG + Intergenic
973107111 4:46353683-46353705 GAGGGCTTATAGAAATTTGAAGG - Intronic
974103239 4:57440307-57440329 AAGGGCCTGTTCAAATCTATTGG - Intergenic
975648982 4:76573464-76573486 AAGGGACTATTCAAATTGATTGG - Intronic
976382314 4:84413635-84413657 ATGTGCATATTAAAATTTGTAGG - Intergenic
979998350 4:127460328-127460350 GAAGGGCTATTGAATTTTGTCGG + Intergenic
980482354 4:133403266-133403288 TAAAGCATATTGAAATTTGTAGG - Intergenic
981302809 4:143208725-143208747 AAGGCACAATTCAAATTTGTGGG + Intronic
983662999 4:170149933-170149955 AAAGGGATATTGAATTTTGTTGG + Intergenic
986159111 5:5208336-5208358 AAGGGCCTATTGAAATTTGTAGG + Intronic
989180130 5:38568346-38568368 AAGGGCCTATGGGAGTTTCTGGG + Intronic
989187061 5:38635957-38635979 ATGGCCCTATGGAAATTTGAGGG + Intergenic
989573778 5:42970712-42970734 AAGGTCCTATTGAAAGTCCTTGG - Intergenic
990688732 5:58337983-58338005 CTGGACCTATTAAAATTTGTGGG + Intergenic
992166838 5:74060675-74060697 AAAGGTCTATTGACATTTGCAGG - Intergenic
992430592 5:76707313-76707335 AAGTGCCTACAGAAATTTCTTGG + Exonic
996000725 5:118360082-118360104 AAGAGTCTTTTGAAATTTGTTGG - Intergenic
999361500 5:150990024-150990046 AAGGGGCTTTTGAAATGTGTTGG + Intergenic
1002776710 6:333929-333951 CAGGGGCTATTAAAATGTGTAGG + Intronic
1003896623 6:10614300-10614322 AAGGGCAAATTGAAATGGGTTGG + Intronic
1008747521 6:54690938-54690960 GAGGTCCTAATGAAATGTGTTGG + Intergenic
1012560761 6:100578421-100578443 AAGGGCCTACTTGAATGTGTAGG - Intronic
1013065663 6:106682624-106682646 AATGGTCTATTTAAAATTGTAGG - Intergenic
1013131013 6:107232817-107232839 AAGAAACTATTGAAGTTTGTTGG - Intronic
1015502586 6:133949803-133949825 AACGGGCTATTGGAATATGTTGG - Intergenic
1017112435 6:150945331-150945353 AAGACCCTATTAAAATTTGTGGG - Intronic
1017330651 6:153194605-153194627 TAGGGGCAATTGAAATTTGCAGG - Intergenic
1020307021 7:6843222-6843244 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020311497 7:6872066-6872088 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1020323065 7:6954404-6954426 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1021832159 7:24625147-24625169 CAGGGTCTGTTGAAATTAGTAGG + Intronic
1022433092 7:30347090-30347112 AGGTGCCTATTTAAATTTTTTGG + Intronic
1022704300 7:32788299-32788321 AAAGGCTTATTGAAATGTATAGG - Intergenic
1022908481 7:34878041-34878063 AAAGGCTTATTGAAATGTATAGG - Intronic
1023555472 7:41417789-41417811 AAGAGCCTAGTGAGATTTATTGG + Intergenic
1028314204 7:89379725-89379747 AAAGTCCTATTGAAGTTTTTTGG - Intergenic
1028914669 7:96244769-96244791 AAGGGCCTATTTAAATTCATTGG + Intronic
1029078175 7:97952166-97952188 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1030274961 7:107710676-107710698 CAGGGCCTATTCTATTTTGTAGG - Intronic
1030826415 7:114164762-114164784 AAAAGCCTATTTAAATTTGGTGG + Intronic
1030828860 7:114196308-114196330 AAGGTCCTTTTAAAATTTTTAGG - Intronic
1031372465 7:120984817-120984839 AAGGGCATGGTGAATTTTGTGGG - Intergenic
1031472987 7:122189985-122190007 AAGGGACTGTTGAAATGTTTGGG + Intergenic
1031572022 7:123370670-123370692 AAGGTGCTATTGAATTTGGTGGG + Intergenic
1036239833 8:7072337-7072359 AAGGGCCTATTGAACTCTGGGGG + Intergenic
1036262044 8:7248817-7248839 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036304547 8:7590741-7590763 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036314083 8:7707356-7707378 AAGGGCCTATTGAATTCTGGGGG - Intergenic
1036355400 8:8038733-8038755 AAGGGCCTATTGAATTCTGGGGG + Intergenic
1036372999 8:8176578-8176600 AAGGGCTTATTGAACTCTGGGGG + Intergenic
1036816608 8:11907281-11907303 AAGGGCCTATTGAACTCTGAGGG - Intergenic
1036877906 8:12489063-12489085 AAGGGCTTATTGAACTCTGGGGG - Intergenic
1036903500 8:12689228-12689250 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1037229437 8:16637484-16637506 ATGGTCCTGTTGAAATTTCTTGG - Intergenic
1037647033 8:20801546-20801568 AAGGGCTCATTGACCTTTGTGGG - Intergenic
1038121941 8:24627077-24627099 AAAGGCCTATTAAAATGAGTGGG - Intergenic
1038799128 8:30733386-30733408 AAGGGCCTATTGAACTCTGGGGG + Intronic
1039533216 8:38283420-38283442 AAGGGCTAGTGGAAATTTGTGGG - Intronic
1041008988 8:53523228-53523250 AAGGGCCTGTTGAACTCTGGGGG - Intergenic
1048956127 8:139537640-139537662 ATAGGCCTCTTGAAATTTGGAGG - Intergenic
1048957373 8:139548132-139548154 AAGGGCCGATTGAACTCTGGGGG - Intergenic
1049856215 8:144863596-144863618 AAGGGGCTTCTGAAATGTGTTGG + Intergenic
1052384646 9:27808732-27808754 AAGGGGTTTTTGAAATGTGTTGG + Intergenic
1052590319 9:30484073-30484095 AAGTGGCTATTGAGTTTTGTTGG + Intergenic
1055007588 9:71526197-71526219 AAGGCCCTATTGAGACTTGGTGG + Intergenic
1056917169 9:90756062-90756084 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1057003092 9:91530895-91530917 AAGGGTCTCTTGAAATCTCTGGG + Intergenic
1059208724 9:112490677-112490699 AAAAGCCTATTAAACTTTGTTGG - Intronic
1059527203 9:115003135-115003157 AAGGGACTATTTAAAATTATTGG + Intergenic
1060020557 9:120126985-120127007 AAGGGCCTAAGGAAACTTTTGGG + Intergenic
1060315714 9:122508505-122508527 AAAGGAATATTGAAATTTGTAGG + Intergenic
1060808457 9:126594172-126594194 AAGGGTCTATTACTATTTGTAGG - Intergenic
1062224082 9:135439214-135439236 AAGGGCCTATTGAACTCTGGGGG - Intergenic
1186340376 X:8639284-8639306 AGCTGCCTATTTAAATTTGTGGG - Intronic
1186708026 X:12163214-12163236 CAGGGTCTAATGATATTTGTTGG + Intronic
1186953014 X:14648655-14648677 CAGGGTCTGTTGAAATTTTTTGG - Intronic
1187035232 X:15531595-15531617 AATGGCCTCTTGAAAGTAGTGGG - Intronic
1188032183 X:25276397-25276419 CAGGGCAAATTGAAAATTGTTGG + Intergenic
1188893676 X:35640883-35640905 AACACCCTATTTAAATTTGTAGG - Intergenic
1189128127 X:38469527-38469549 AAGGGCATATTTAAATTTGCTGG + Intronic
1189510381 X:41655982-41656004 ATGGCCCTATGGAAATTTGAGGG + Intronic
1191641120 X:63430571-63430593 AAGGGGCTTCTGAAATGTGTTGG + Intergenic
1193187640 X:78531897-78531919 AAGGGGGTATAGATATTTGTAGG + Intergenic
1193935862 X:87620436-87620458 ATGGGACTATTGAAAATTGCTGG - Intronic
1194400555 X:93434469-93434491 AAGGGTCTATTGAACTCTGGGGG + Intergenic
1196192924 X:112813251-112813273 AAGGCCCTATTGAGAGCTGTGGG - Intronic
1197176253 X:123488680-123488702 AAGGGGATATTTAAATTTGAAGG - Intronic
1199033803 X:143029547-143029569 AAGGAGCTTTTGAAATATGTTGG + Intronic
1199311458 X:146325660-146325682 AAGGGCTTATGGAAATTTTGGGG + Intergenic
1200948291 Y:8867426-8867448 AAGGGCCTATAGAACTCTGGGGG + Intergenic