ID: 986162216

View in Genome Browser
Species Human (GRCh38)
Location 5:5240345-5240367
Sequence CTGTGTCACAGCATTGACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 184
Summary {0: 1, 1: 0, 2: 4, 3: 18, 4: 161}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986162210_986162216 12 Left 986162210 5:5240310-5240332 CCAGAGGTGAAGCCCCTTGCTGT 0: 1
1: 0
2: 1
3: 9
4: 104
Right 986162216 5:5240345-5240367 CTGTGTCACAGCATTGACCTTGG 0: 1
1: 0
2: 4
3: 18
4: 161
986162209_986162216 13 Left 986162209 5:5240309-5240331 CCCAGAGGTGAAGCCCCTTGCTG 0: 1
1: 0
2: 2
3: 15
4: 180
Right 986162216 5:5240345-5240367 CTGTGTCACAGCATTGACCTTGG 0: 1
1: 0
2: 4
3: 18
4: 161
986162213_986162216 -2 Left 986162213 5:5240324-5240346 CCTTGCTGTGTGATGACCTACCT 0: 1
1: 0
2: 2
3: 15
4: 168
Right 986162216 5:5240345-5240367 CTGTGTCACAGCATTGACCTTGG 0: 1
1: 0
2: 4
3: 18
4: 161
986162212_986162216 -1 Left 986162212 5:5240323-5240345 CCCTTGCTGTGTGATGACCTACC 0: 1
1: 0
2: 0
3: 11
4: 105
Right 986162216 5:5240345-5240367 CTGTGTCACAGCATTGACCTTGG 0: 1
1: 0
2: 4
3: 18
4: 161
986162211_986162216 0 Left 986162211 5:5240322-5240344 CCCCTTGCTGTGTGATGACCTAC 0: 1
1: 0
2: 1
3: 17
4: 157
Right 986162216 5:5240345-5240367 CTGTGTCACAGCATTGACCTTGG 0: 1
1: 0
2: 4
3: 18
4: 161

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986162216 Original CRISPR CTGTGTCACAGCATTGACCT TGG Intronic
900793451 1:4693905-4693927 CTGTGCCACAGCACTGAGGTGGG - Intronic
902239963 1:15081842-15081864 GTGGGTCACAGCAAGGACCTTGG + Intronic
903678394 1:25081067-25081089 TTGGGTTAAAGCATTGACCTGGG - Intergenic
904116198 1:28163749-28163771 CTGTGGGCCAACATTGACCTAGG + Intronic
905166326 1:36085266-36085288 CTGTGTCAGGGCATCGATCTCGG - Exonic
906288593 1:44604460-44604482 CTGTTTCACACCCATGACCTTGG - Intronic
907433377 1:54428073-54428095 CTGTGTACCAGCCTTGAGCTAGG + Intergenic
907710548 1:56876614-56876636 CTGTGTCACACCATTAGCCCTGG - Intronic
909064316 1:70915807-70915829 CTGTTTCTCAGAATTGGCCTTGG + Intronic
909305767 1:74074999-74075021 CTCTCTCACAGCATTGGCCAAGG - Intronic
916405785 1:164496808-164496830 CTGTCTCATAGCTTTGCCCTCGG - Intergenic
917194624 1:172452289-172452311 CTGGGTCACAGCTTTCTCCTGGG + Intronic
919742291 1:200988443-200988465 CTGGCTCACAGCATGTACCTGGG - Intronic
920396124 1:205647433-205647455 ATCTGCCACAGCCTTGACCTTGG - Intergenic
920707875 1:208267920-208267942 CTGTATCACAGCATTCTCCTAGG - Intergenic
921583434 1:216922093-216922115 CTATGTCTCACCATGGACCTTGG + Intronic
922753544 1:228082182-228082204 CTGTGTCCCCGCACTGGCCTCGG - Intergenic
1064116918 10:12586031-12586053 GTTTGTCATAGCAGTGACCTTGG - Intronic
1064672220 10:17727337-17727359 CTATGTCACTGAATGGACCTGGG + Intergenic
1071092430 10:81934439-81934461 GTGTGTCACAGCAATTACCACGG - Intronic
1075168614 10:120092250-120092272 CTGGGTCACAGCTTTGACCTGGG - Intergenic
1076426342 10:130370063-130370085 CTGGGTCACAGCAAAGACCTGGG - Intergenic
1077489538 11:2854233-2854255 CTGTGTGTCAGCATTGGCCAGGG - Intergenic
1077509464 11:2949095-2949117 CTGTGTCACAGGTTTGACATAGG - Intronic
1077522778 11:3046123-3046145 CTGTGTAACAGAATGGACCATGG - Intronic
1083196323 11:61090739-61090761 CTGTGTCACAGTAGAGATCTTGG - Intergenic
1087154651 11:94889098-94889120 ATGTGTCACGGCATTTATCTAGG - Intergenic
1087332849 11:96804309-96804331 CTGTGAGACAACATAGACCTTGG + Intergenic
1088582794 11:111331630-111331652 CTGTGTCAAAGGATTGCCCACGG - Intergenic
1088637748 11:111840238-111840260 CTCTGCCAGAGAATTGACCTGGG + Intronic
1088789031 11:113208019-113208041 TTGTGGCAGAGCAGTGACCTGGG - Intronic
1094177292 12:27553965-27553987 CTGTCTCACAGAATTGAGCAGGG + Intronic
1095749613 12:45696437-45696459 CAGTGTCACAGCCCTGACTTGGG + Intergenic
1096367841 12:51043805-51043827 CTGTGTCATGTCCTTGACCTTGG - Intergenic
1097137615 12:56871756-56871778 CTCTGTCACAGCCTTCACCCAGG - Intergenic
1100392681 12:94157711-94157733 CTGCATAACAGCATTGACCAGGG - Intronic
1102477518 12:113198309-113198331 CTGTGACACAGCCTTTTCCTTGG - Intronic
1103026633 12:117579576-117579598 CTCTGTCCCAGAACTGACCTTGG - Intronic
1104482211 12:129117587-129117609 CTGGGTCCCAGCTTTGACCTTGG - Intronic
1104927585 12:132321731-132321753 CGGTGCCACTGCAGTGACCTGGG - Intronic
1105914997 13:24906169-24906191 CTGTGGCACAGCTTTGACAGGGG + Exonic
1106144049 13:27036106-27036128 CTGTGTCACAGCTTCCATCTCGG - Intergenic
1106794150 13:33187159-33187181 CTGTTTAAGAGCATTGACCTGGG + Intronic
1108747546 13:53410178-53410200 CTGTTTCTCTGCATTGAGCTGGG - Intergenic
1108834689 13:54528444-54528466 TTGGGTCACAGTATTGACTTAGG + Intergenic
1111168914 13:84499972-84499994 CTGTTTGACAGCCTTGACCAGGG - Intergenic
1113836451 13:113331271-113331293 CTGAGCCACAGGATTGACCATGG + Intronic
1113904992 13:113815035-113815057 CAGGGTCAGAGCATTGCCCTGGG + Exonic
1114435075 14:22699478-22699500 CTGTGTTCCAGCATTGACTTGGG - Intergenic
1118444509 14:65839119-65839141 CTCCTTCCCAGCATTGACCTAGG + Intergenic
1118810571 14:69270358-69270380 CTGTGTCATACCAGTCACCTGGG - Intronic
1120567838 14:86081478-86081500 CTTTGTCACAGGATTGCCCTTGG - Intergenic
1121889812 14:97579033-97579055 CTGTGTGACAGCAGGCACCTGGG - Intergenic
1122791940 14:104187670-104187692 CTGTGGCACAGCCTGGCCCTGGG + Intergenic
1129694047 15:77730622-77730644 CTGGGCCACAGCATCAACCTGGG + Intronic
1131442495 15:92469518-92469540 CTGTCTCACAGCATTGCTCCAGG - Intergenic
1132940040 16:2501918-2501940 CTTTGTCATTGCAATGACCTGGG + Exonic
1133604189 16:7369962-7369984 ATGTGTCAGAGCCTTGAGCTAGG + Intronic
1133740890 16:8650390-8650412 CTGTGTAACAGCAATGACCTTGG + Intergenic
1134099464 16:11441457-11441479 CTCTAGCACAGCTTTGACCTTGG - Intronic
1135624055 16:23980343-23980365 CTGTGGGTCAGCTTTGACCTAGG + Intronic
1137751404 16:50863554-50863576 CTGTGTGGCAGCATGGACCAGGG + Intergenic
1138449829 16:57087053-57087075 GGGTGTCACAGGAGTGACCTGGG - Intergenic
1139812925 16:69637684-69637706 ATGTGTCACAGGATGGACCCAGG - Intronic
1143353335 17:6306054-6306076 CTGTGTCTCAGCAATGGCCTGGG - Intergenic
1148745270 17:49914530-49914552 CTGTGTCACAGTTTTCCCCTTGG - Intergenic
1148915802 17:50977539-50977561 CTGTGACACAGGATTTACTTAGG + Intronic
1149652318 17:58283582-58283604 CTGTGTCACACTGCTGACCTTGG - Intergenic
1150759326 17:67945997-67946019 CTGAGGCACAGCAATGACTTGGG - Exonic
1151681938 17:75626968-75626990 CTCTGCCACAGCTCTGACCTGGG + Exonic
1152314593 17:79572743-79572765 TTGTCTCACAGCAAAGACCTGGG + Intergenic
1153793331 18:8599575-8599597 CTGTGTCACTGCATGGGACTTGG + Intergenic
1155925275 18:31649343-31649365 CTGTGTCCAGGCATTGCCCTTGG - Intronic
1159458632 18:68694251-68694273 GTGTGTCACAGCCCTGACTTGGG - Intronic
1160371328 18:78374063-78374085 CTGTGTCAGAGCATTGAGCTCGG + Intergenic
1161373455 19:3926772-3926794 CTGGGTCTCAGCATTGCCCTGGG + Exonic
1162885816 19:13696308-13696330 GTGTGTCACAGGCTTGCCCTGGG - Intergenic
1163195628 19:15717639-15717661 CTGTGTCAAAACATGGACCTGGG + Intergenic
1165484663 19:36088473-36088495 GTGTTTAACAGCTTTGACCTTGG + Intronic
925983130 2:9192957-9192979 CTGTGTGACTGCAGGGACCTGGG + Intergenic
927416140 2:22882590-22882612 CTGTGTCTCAGGATTGTCCAGGG - Intergenic
928186879 2:29118316-29118338 CTGTGTTAAAGCATGGACCAAGG + Intronic
930398559 2:50853074-50853096 ATGTGTCACAGCATCTTCCTGGG - Intronic
933126717 2:78618268-78618290 TTGTGTGACAACATTGACCTTGG + Intergenic
933828808 2:86189481-86189503 CTGTGTAACAGCATTAATCATGG - Intronic
934554858 2:95281819-95281841 CTGTGGCACAGCACAGACCAGGG - Intronic
935123854 2:100205535-100205557 CTGTGCCACAGCATTGCCAAGGG + Intergenic
936654999 2:114474716-114474738 CTGGGACACAACTTTGACCTTGG + Intronic
937124896 2:119468323-119468345 CTGTGTGACACCATGGAGCTTGG - Intronic
937666301 2:124490933-124490955 CTATTAGACAGCATTGACCTGGG + Intronic
941657107 2:168156061-168156083 CTATGACACAGCACTGACATTGG - Intronic
947950069 2:234139309-234139331 CCCTGTCACAGCACTGCCCTGGG - Intergenic
1168737903 20:159612-159634 CTGTGTACCAGCAGTGAACTGGG + Intergenic
1169304605 20:4477638-4477660 GGGTGTCAGAGCATTGACCCCGG + Intergenic
1169562324 20:6815112-6815134 CTGTGTCCTAGCATTTTCCTAGG + Intergenic
1169833454 20:9851693-9851715 CTGTGGGACAGCATTGACATAGG - Intergenic
1172241050 20:33412665-33412687 CGGCGTCAGAGTATTGACCTGGG + Exonic
1172933551 20:38602289-38602311 CTGGGACACAGCATTGCCCTGGG + Intronic
1173036866 20:39420127-39420149 CTATGTCCCAGCACTGAACTAGG - Intergenic
1174404587 20:50295008-50295030 GTGTGTCACAGCACTGAGATTGG - Intergenic
1177619832 21:23574638-23574660 CTTTGTGACACCATTGAACTTGG - Intergenic
1178732400 21:35116911-35116933 CTCTGTCCCAGCCTTCACCTTGG - Intronic
1179429575 21:41310685-41310707 CTGTGTCCCAGCATGCACCCTGG - Intronic
1181963747 22:26642291-26642313 CTTTGTCACAGCTTTGCTCTTGG - Intergenic
1182795977 22:32991969-32991991 CTGAGTTACAGCCTTGCCCTGGG - Intronic
1182954293 22:34406850-34406872 CTGTGTCACAGCATGCAGTTTGG + Intergenic
1182994340 22:34798997-34799019 CTGGTTCACAGCATTTCCCTTGG - Intergenic
1183637034 22:39070388-39070410 ATGGGTCTCAGGATTGACCTGGG - Intronic
1184516142 22:44963996-44964018 CTGTGTTCCAGCCCTGACCTTGG + Intronic
1185186224 22:49402174-49402196 CTGGGTGACAGCGATGACCTTGG + Intergenic
950058587 3:10049947-10049969 CTCAGTCACACCATTGACTTGGG - Intronic
952886349 3:38013743-38013765 CTTTGGCAGAGCCTTGACCTTGG - Intronic
953334217 3:42080127-42080149 CTGAGTCACAGAAATGACATCGG + Intronic
953920864 3:46950242-46950264 CTGTTTCCCAGCATGGATCTGGG - Intronic
954901099 3:54020789-54020811 TTGTGAAACAGCATTCACCTGGG + Intergenic
956712470 3:72050555-72050577 CTGGGTGACAGCATTGTGCTAGG - Intergenic
963549562 3:146702743-146702765 AAGTGCCACACCATTGACCTTGG - Intergenic
967361149 3:188633271-188633293 CTGTGTCTTAGCAGTGACGTGGG - Intronic
968077800 3:195825851-195825873 CTGTGCCACAGAATCCACCTGGG - Intergenic
968271779 3:197408569-197408591 CGGTGGCACAGGACTGACCTGGG + Intergenic
968836507 4:2968813-2968835 CTCTGTCACAGGAGTGACCGTGG - Intronic
969666030 4:8558057-8558079 CTGGGTCACAGCAATGATCAAGG - Intergenic
971869314 4:32215666-32215688 GTGTGTCACAGACTTGGCCTGGG + Intergenic
974589969 4:63934016-63934038 ACATGTCACAACATTGACCTGGG + Intergenic
976047077 4:80963273-80963295 CTGTGTCACTGCTTTGATCATGG + Intronic
979266678 4:118711783-118711805 CTATATGTCAGCATTGACCTGGG + Exonic
981440976 4:144781398-144781420 CTGTGTATCAGCAATGATCTGGG - Intergenic
981884541 4:149658081-149658103 ATGCTTCACAGCATTGAGCTGGG - Intergenic
982001727 4:151026836-151026858 CTGTGTCACACCAGTTTCCTAGG - Intergenic
982091442 4:151883375-151883397 TTGTGTGACAGCATTGTTCTAGG + Intergenic
983168336 4:164506668-164506690 CTATGACACTGTATTGACCTGGG + Intergenic
985955749 5:3264666-3264688 ATGTGTCAAAGAATTGCCCTAGG - Intergenic
986162216 5:5240345-5240367 CTGTGTCACAGCATTGACCTTGG + Intronic
987299970 5:16588526-16588548 CTTTGACACAGGAGTGACCTTGG - Intronic
990290026 5:54340640-54340662 CTGTGTGTCAGCAATGGCCTTGG - Intergenic
990606642 5:57417143-57417165 CTGTGTCTCAGGAATGACCCAGG - Intergenic
991237753 5:64418950-64418972 CTGTGTCACATCCATAACCTTGG + Intergenic
991974937 5:72176366-72176388 TAGTGTCACAGCACTGACCTTGG + Intronic
992533301 5:77672610-77672632 GTGTTTCAGAGCATGGACCTTGG - Intergenic
992704795 5:79380251-79380273 CTGTGTGACAGCACTGCTCTTGG + Intronic
994469799 5:100188567-100188589 CTGTATCACAGCATTTATCATGG + Intergenic
994778069 5:104060941-104060963 CTGTGTCAGAGGAAAGACCTGGG + Intergenic
996787483 5:127255939-127255961 CTGTGCTACAGAACTGACCTAGG + Intergenic
999779110 5:154834986-154835008 CTGTGCCTCAGCAGTGAGCTGGG - Intronic
1000164247 5:158632083-158632105 ATGTGTCATAGCATTGAAATTGG + Intergenic
1001646891 5:173288731-173288753 CTGTGTCACAGGATTGCTCGGGG - Intergenic
1005396356 6:25386181-25386203 CAGTGTCAAAGCAGTTACCTTGG + Intronic
1007751957 6:44076380-44076402 TTGGGTGACAGCAATGACCTTGG - Intergenic
1008091168 6:47295136-47295158 CTGGGTCTCAGCATTCACCCTGG + Intronic
1012686176 6:102252649-102252671 CTGTGTGACTGCTTTGAGCTGGG - Intergenic
1013039370 6:106418346-106418368 CTGTGTCACAGGTTTCATCTGGG + Intergenic
1015510856 6:134037061-134037083 CTGAGTCTCAGCACAGACCTGGG - Intronic
1018203539 6:161416105-161416127 CTGTGTCAGAGCATTTCCATAGG - Intronic
1020827435 7:13047540-13047562 CTGTCTCACAGCTTTTGCCTAGG + Intergenic
1021565961 7:22016814-22016836 CTGTGTCACATCTCTCACCTGGG + Intergenic
1022889530 7:34682236-34682258 CTGTGTCACAGCACTGCCCTGGG + Intronic
1023571815 7:41580241-41580263 GTGTGTCATAGCTTTGAACTTGG - Intergenic
1033101561 7:138477424-138477446 CTGGTTCACAGTATTGACTTTGG + Intronic
1035738682 8:1908647-1908669 CGATGTCACAGCCTTGGCCTTGG + Intronic
1037509653 8:19569699-19569721 CTGGGTCATAGCATAGGCCTAGG - Intronic
1037808030 8:22069278-22069300 CTGTGCCACAACATTGCCCTGGG + Intronic
1039126595 8:34209880-34209902 ATGTATCATAGCATTGATCTGGG - Intergenic
1040775842 8:51042441-51042463 CTGTGTTACAGCTATGATCTTGG - Intergenic
1040775846 8:51042477-51042499 CTGTGTTACAGCTATGAACTTGG - Intergenic
1042729010 8:71910605-71910627 CTGTGTCACAGCATTTGCAGTGG + Intronic
1046367260 8:113251398-113251420 CTGTGTCTCATCATTTTCCTTGG - Intronic
1046373979 8:113351129-113351151 CTTTATCACAGCACTCACCTTGG + Intronic
1047315691 8:123730998-123731020 CTGTGCCTCAGCATTGACTATGG - Intronic
1047505170 8:125473914-125473936 CTGTGTCTCAGCACTGGGCTAGG - Intergenic
1049374946 8:142284967-142284989 CTGTGTAACAGCACTGAGCATGG + Intronic
1049439389 8:142602292-142602314 CTGGTACACAGCCTTGACCTGGG - Intergenic
1050485717 9:6132690-6132712 CTCTGTCACAGCATTGAGGTAGG + Intergenic
1050694064 9:8259902-8259924 CTTTGTCAGACCATTGACCTTGG + Intergenic
1051377795 9:16421628-16421650 CTGTGTCAGAGCAGGGACCGTGG - Intronic
1051490564 9:17659399-17659421 CAGTGTCATAGAATTGTCCTTGG + Intronic
1053206209 9:36188675-36188697 CTGTCTCCCAGCAATCACCTGGG + Intergenic
1060800280 9:126540154-126540176 GTGTGACACAGCATTGCCCCGGG + Intergenic
1061303932 9:129722020-129722042 CTGTGTCCCAGCACTGAGCTGGG + Intronic
1193553253 X:82924868-82924890 CTCAGTCTCAGCATGGACCTTGG - Intergenic
1194616029 X:96104248-96104270 CAGTGTGACAGTATTGGCCTTGG - Intergenic
1195650011 X:107274394-107274416 CTGAGTCACAGCATTGAGAGTGG - Intergenic
1197719088 X:129732729-129732751 CTGTATCACATCCATGACCTAGG + Intergenic
1200132275 X:153857136-153857158 CTCTCTCACAGCCTTGATCTCGG - Intergenic
1202585346 Y:26418566-26418588 TTCTGTCACAGCATTTACCATGG - Intergenic