ID: 986165247

View in Genome Browser
Species Human (GRCh38)
Location 5:5267305-5267327
Sequence TGTCCTCGGGATAAGGCAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 1, 1: 1, 2: 10, 3: 81, 4: 233}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986165247_986165256 10 Left 986165247 5:5267305-5267327 CCCTTTGCCTTATCCCGAGGACA 0: 1
1: 1
2: 10
3: 81
4: 233
Right 986165256 5:5267338-5267360 TGTATCCTGGGTTATCGCCTTGG 0: 1
1: 1
2: 52
3: 79
4: 148
986165247_986165260 27 Left 986165247 5:5267305-5267327 CCCTTTGCCTTATCCCGAGGACA 0: 1
1: 1
2: 10
3: 81
4: 233
Right 986165260 5:5267355-5267377 CCTTGGTGTGCTGGAAAAATTGG 0: 1
1: 9
2: 66
3: 137
4: 315
986165247_986165255 -2 Left 986165247 5:5267305-5267327 CCCTTTGCCTTATCCCGAGGACA 0: 1
1: 1
2: 10
3: 81
4: 233
Right 986165255 5:5267326-5267348 CAGAGGGCTTTCTGTATCCTGGG 0: 99
1: 258
2: 242
3: 135
4: 323
986165247_986165258 18 Left 986165247 5:5267305-5267327 CCCTTTGCCTTATCCCGAGGACA 0: 1
1: 1
2: 10
3: 81
4: 233
Right 986165258 5:5267346-5267368 GGGTTATCGCCTTGGTGTGCTGG No data
986165247_986165254 -3 Left 986165247 5:5267305-5267327 CCCTTTGCCTTATCCCGAGGACA 0: 1
1: 1
2: 10
3: 81
4: 233
Right 986165254 5:5267325-5267347 ACAGAGGGCTTTCTGTATCCTGG 0: 158
1: 206
2: 114
3: 62
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986165247 Original CRISPR TGTCCTCGGGATAAGGCAAA GGG (reversed) Intronic
900751463 1:4400575-4400597 TGCTCTTGGGATAAGGCAGAGGG - Intergenic
902236544 1:15061014-15061036 TGTCTTCAGGATATGGCAGAGGG - Intronic
902679375 1:18032179-18032201 TGTCATCTGGAAAAGGCAAGGGG - Intergenic
905526158 1:38641639-38641661 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
908269921 1:62412480-62412502 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
908383059 1:63614763-63614785 TATCCTAGGGATAAGGAAAATGG - Intronic
908908753 1:69047635-69047657 TGTCCTTGCAATAAGGCAAAAGG + Intergenic
908929890 1:69305954-69305976 TCTCCTTGCGATAAGGCAGAGGG - Intergenic
910050971 1:82973581-82973603 TGTCCTTGGGATAAGGTAGAGGG + Intergenic
910748866 1:90605606-90605628 TGACCTCAGGACAAGGCACAGGG - Intergenic
911430052 1:97773928-97773950 TGTCCTTGTGATAAGGCAGAAGG + Intronic
912002748 1:104855908-104855930 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
914996006 1:152543824-152543846 TGTCCTTGTGATAAGTCAGAGGG + Intronic
917554278 1:176067736-176067758 TGACCTTGTGATAAGGCAGAGGG + Intronic
918024768 1:180732771-180732793 TGTCCTTGCGACAAGGTAAAGGG - Intronic
919110873 1:193217312-193217334 TGTCCTTGTGATAAGGTAGAGGG - Intronic
919183711 1:194117956-194117978 TGTCCTTGTGATCAGGCAGAGGG - Intergenic
919199914 1:194342897-194342919 TGTCCTTGTAATAAGGCAGAGGG + Intergenic
920756426 1:208738243-208738265 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
921120235 1:212130059-212130081 TAGCCTGGGAATAAGGCAAAAGG - Intergenic
921222889 1:212986230-212986252 TGCCTGCAGGATAAGGCAAAAGG - Intronic
921403565 1:214753622-214753644 TGTCCTCGCGATAAGGCACAGGG + Intergenic
921891033 1:220353623-220353645 TGTCCTTGAGATAGGGCAGAGGG + Intergenic
922067505 1:222158420-222158442 TTTCCTCAGGAAAAAGCAAAAGG - Intergenic
922467833 1:225856572-225856594 TGTCCCCAGGAGAATGCAAACGG - Intronic
923252703 1:232191986-232192008 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
1063592105 10:7405430-7405452 TGTGCTCTGGAAAAGGCGAAGGG - Intronic
1063710465 10:8472432-8472454 TGTTCACGGCAGAAGGCAAAGGG + Intergenic
1064125809 10:12658930-12658952 TGTCCTTGTGATAAGGCAGAGGG + Intronic
1064680408 10:17806249-17806271 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1064795798 10:19009900-19009922 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1068022707 10:51604886-51604908 TGTCCTTGCAATAAGGCAGAGGG - Intronic
1068196696 10:53726798-53726820 AGTCCTTGCGATAAGGCAGAGGG - Intergenic
1068407197 10:56605047-56605069 TGTCCTTGCAATAAGGCAGAAGG + Intergenic
1070380690 10:75878170-75878192 TGTCCTTGGGATAAGCCAGAGGG - Intronic
1070855227 10:79603266-79603288 TGCCCTTAGGATAAGGCAGAGGG - Intergenic
1071195454 10:83153753-83153775 TGTCCTTGCGATAAAGCAGAGGG + Intergenic
1071495903 10:86167487-86167509 GGACCTCAGGATCAGGCAAACGG + Intronic
1071867031 10:89746235-89746257 TGTCCTTGCAATAAGGCAGAGGG - Intronic
1072297405 10:94024120-94024142 TGTGCACGTGATAAGGGAAAAGG + Intronic
1072380143 10:94859423-94859445 TGACCTTGCGATAAGGCAGAGGG - Intergenic
1072392351 10:95000158-95000180 TGTCCTTGCGATAAGGCAGAGGG - Intergenic
1073861356 10:107745657-107745679 TGTCCTAAGGATATGGCTAAAGG + Intergenic
1074096544 10:110318301-110318323 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1074965450 10:118487272-118487294 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
1077813100 11:5658477-5658499 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1079538053 11:21539363-21539385 TGTCCTTGTGAAAAGGCAGAGGG - Intronic
1081075437 11:38667659-38667681 TGCCCTTGAGATAAGGCAGAGGG - Intergenic
1083107671 11:60374074-60374096 TGTCCTTGCGATAAGGTAGAGGG + Intronic
1083388778 11:62333070-62333092 TGTCCTTGTGATAAGGCAGAAGG - Intergenic
1083880968 11:65548089-65548111 TGCCCTGGGGATATGGCAGAAGG - Intronic
1087139986 11:94755871-94755893 TGTCCTTGGGATAAGGCAGAGGG - Intronic
1087677117 11:101175824-101175846 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1090458115 11:126866991-126867013 TGTCCTTGCGATAAGGCAGAGGG + Intronic
1090674926 11:128983139-128983161 TGTCCTCGGTACAAGGGGAATGG - Intronic
1092124712 12:6066939-6066961 TGTCCTGGGGACCAGGCAGAGGG - Intronic
1093683562 12:22030652-22030674 TGCCCTTGTGATAAGGCAGAAGG + Intergenic
1094361758 12:29638542-29638564 TGTCCTGGTGATAAGGCTGAGGG + Intronic
1094406498 12:30121680-30121702 TGTCCTTGAGATAAGGCAGAGGG + Intergenic
1094596745 12:31873098-31873120 TGCCCTTGTGAAAAGGCAAAAGG - Intergenic
1096933543 12:55242625-55242647 TGTCCTTGCGATAAGGCAAAGGG + Intergenic
1097352351 12:58562532-58562554 TGTCCTTGTGATAAGGCATAGGG - Intronic
1099271200 12:80513123-80513145 TGTCCTTGCGATAAGGCAGGGGG - Intronic
1099653311 12:85456878-85456900 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
1102574931 12:113850216-113850238 TGTCCCCCGGTCAAGGCAAAGGG - Intronic
1103224403 12:119274545-119274567 TGTCCCTGTGATAAGGCAGAGGG + Intergenic
1104238283 12:126961096-126961118 TGTCGTCAAGATAAGGCAGAGGG - Intergenic
1106541013 13:30690227-30690249 TGTCCTTGTGATAAGGTAGAGGG + Intergenic
1109651272 13:65330616-65330638 TGTCCTTGCGATAAGGGAGAAGG - Intergenic
1110484247 13:76019656-76019678 TGTCCTTGCTATAAGGCAAAAGG - Intergenic
1111184884 13:84720563-84720585 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1111206746 13:85020586-85020608 TTTCCTTGCGATAAGGCAGAGGG + Intergenic
1111405061 13:87793247-87793269 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1112634588 13:101201020-101201042 TGTGCTTGGGATATAGCAAAGGG - Intronic
1114370149 14:22077511-22077533 TGTCCTGGGTATATAGCAAATGG - Intergenic
1116298324 14:43141548-43141570 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
1117046212 14:51816225-51816247 TGTCCTTGCGATAAGGCAGAGGG - Intergenic
1118487215 14:66225231-66225253 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
1119000083 14:70873713-70873735 TGTCCTTGTGATAGGGCAAAGGG + Intergenic
1119703768 14:76771680-76771702 AGTCCACGGAGTAAGGCAAATGG - Intronic
1120294412 14:82622396-82622418 TCTCCTTGTGATAAGGCAGAGGG - Intergenic
1123809053 15:23905130-23905152 TGTCCTCGCAATAAGGCAGAAGG - Intergenic
1124191289 15:27579344-27579366 TGGTCTAGGGATAAGGTAAATGG + Intergenic
1124405297 15:29386185-29386207 TGTCCTTGTGATAAGGCAGAGGG + Intronic
1125916367 15:43491586-43491608 TATCCTTGGGATGAGGCAACAGG + Intronic
1127027609 15:54824854-54824876 TGTCCTTGCGATAAGGCAGAGGG - Intergenic
1130073780 15:80671209-80671231 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
1131557717 15:93414109-93414131 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
1132659835 16:1056434-1056456 TGCCCTCGAGAAAAGGCAGAGGG - Intergenic
1134822304 16:17256776-17256798 TGTCCTCCTGAGAAGGCAAATGG - Intronic
1134873648 16:17676034-17676056 TGCCCTCGTGAAAAGGCAGAGGG - Intergenic
1138220059 16:55242686-55242708 TGTTCTTGGGATAAGGCAAAGGG + Intergenic
1139284481 16:65798212-65798234 TGTCCTTGCGATAAGGCAGAGGG + Intergenic
1142108147 16:88317300-88317322 TGCCCTGGGGAGAAGGCAGAAGG - Intergenic
1144320815 17:14117784-14117806 TGTCCTTGGGATAAGGCAGAAGG - Intronic
1146565679 17:33910931-33910953 TGTCCCCAGGAAAAGCCAAAGGG + Intronic
1147671370 17:42178733-42178755 TGCCCTCTGGATAAGGCTAGGGG + Intronic
1149217072 17:54370074-54370096 TGTCCTTGTAATAAGGCAGAAGG - Intergenic
1149318266 17:55458936-55458958 TGTCCTTGTGATAAGGAAGAGGG + Intergenic
1149815895 17:59723485-59723507 TGTCCTTTGGATTTGGCAAATGG + Intronic
1150855170 17:68745425-68745447 TGTCCTTGCAATAAGGCAGAAGG + Intergenic
1150999054 17:70352280-70352302 TGTCCTTGCTATAAGGCAGAGGG + Intergenic
1153351340 18:4083902-4083924 TGTCCTAGAGATAAGGCAGAGGG - Intronic
1153773780 18:8435426-8435448 TCTCCTTGTGATAAGGCAGAGGG + Intergenic
1153990458 18:10394594-10394616 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1155399726 18:25424786-25424808 TGTTCTTGGCACAAGGCAAAAGG - Intergenic
1156514958 18:37671527-37671549 TATCCTCACGATAAGGCAGAGGG + Intergenic
1156691062 18:39707823-39707845 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
1157002345 18:43542176-43542198 TGTCCTTGAGATAAGGCAGAGGG - Intergenic
1157075219 18:44458527-44458549 TCTCCTCTGTAAAAGGCAAAGGG + Intergenic
1157534952 18:48451332-48451354 TGTCCTTGAGATAAGGCAGGGGG - Intergenic
1157855430 18:51100623-51100645 TGCCCTTGCGATAAGGCAGAGGG + Intergenic
1158856082 18:61544369-61544391 TGTCCTTGTGATAAGGCAGAGGG - Intronic
1158968568 18:62644825-62644847 TGCCCTCGTGAAAAGGCAGAGGG + Intergenic
1159417579 18:68173117-68173139 TGTCCTTGCGATAAGGCAGAGGG - Intergenic
1163837306 19:19582682-19582704 TGTCCTTGAGATAGGGCAGAGGG + Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1167683769 19:50942764-50942786 TGTGCTGGGGATAAGGCATTGGG - Intergenic
1168525914 19:57088646-57088668 TGGACCCGGGAGAAGGCAAATGG + Intergenic
924985906 2:269748-269770 TGTCTTCAAGAGAAGGCAAAAGG - Intronic
925049158 2:797762-797784 TGCCCTTGTGATAAGGCAGAAGG - Intergenic
925092534 2:1167085-1167107 TGTCCTTGCGATAAGGCAGAGGG + Intronic
926961663 2:18364492-18364514 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
928266020 2:29812598-29812620 TGTGCTTGGTAAAAGGCAAATGG - Intronic
928819363 2:35342323-35342345 TGTCCTTGTGATAAGGCAGGGGG + Intergenic
929324464 2:40591431-40591453 TGTGGTCGGAATAAGGTAAAGGG + Intronic
930309038 2:49714468-49714490 TGTCCTTGTGATTAGGCAGAGGG + Intergenic
932931468 2:76044859-76044881 TGTCCTTGAGATAAGGCAGGGGG - Intergenic
933141420 2:78795601-78795623 TGTCCTTGCAATAAGGCAGAAGG - Intergenic
933187152 2:79290877-79290899 TGTCCTTGTGATAAGGCAGGGGG + Intronic
933438702 2:82282458-82282480 TGTCCTTGCGATAAGGCAGAGGG - Intergenic
934957090 2:98631810-98631832 TGTCCTTGTGATAAGGCAGGGGG + Intronic
936863916 2:117055831-117055853 TGTCCTTGCCATAAGGCAGAGGG - Intergenic
938035084 2:128028377-128028399 TGCCCTCAGGTTAAGGCATAGGG - Intergenic
938121122 2:128634743-128634765 TGTTTTCGGGATAAGGTACAAGG + Intergenic
939436237 2:142181197-142181219 TGTCCTTGCGATAAGGCAGAAGG + Intergenic
939451186 2:142376559-142376581 TGTCCTTGCGATAAGGCAGAGGG + Intergenic
941309637 2:163912744-163912766 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
942075635 2:172354864-172354886 TGTGCTCAGGAGCAGGCAAAGGG + Intergenic
942740611 2:179173163-179173185 ACTCCTAGGTATAAGGCAAAGGG - Intronic
942779112 2:179620056-179620078 TGTCATCAGGTTTAGGCAAAAGG - Intronic
943178092 2:184503934-184503956 TGTCCTCTGAATAAGGAAAATGG + Intergenic
944306900 2:198189021-198189043 TGTCCTTGAGATAAGGCAGAGGG + Intronic
944530704 2:200665109-200665131 TGTCCTCAGGACAAGACAACTGG + Intronic
944564969 2:200980654-200980676 TGTCTTCGGGATAAAGGAGATGG + Exonic
948159679 2:235813732-235813754 TGTCCTTGCAATAAGGCAGAGGG - Intronic
948525386 2:238567892-238567914 TGTCCTTGCGACAAGGCAGAGGG + Intergenic
1169282344 20:4278383-4278405 TCCCCTGGGGATAAGGCAGATGG - Intergenic
1169901920 20:10562168-10562190 TGTCCTTGAGATAAGGCAGAGGG - Intronic
1170667367 20:18398470-18398492 TGTCCACGGGATCAGGCTGAAGG - Intronic
1171072875 20:22092370-22092392 TGCCCTTGAGATAAGGCAGAGGG - Intergenic
1171356474 20:24549677-24549699 TGTCCTTGCGAAAAGGCAAAGGG - Intronic
1174432202 20:50478586-50478608 TGTCCTTGAGATAAGGCAAGGGG - Intergenic
1175511295 20:59527991-59528013 TGTTCTTGCGATAAGGCAGAGGG + Intergenic
1178195789 21:30344140-30344162 TGTCTTTGTGATAAGGCAGAGGG - Intergenic
1178199853 21:30391053-30391075 TGTCCTTGTGATAAGGCAGAGGG + Intronic
1178213761 21:30569361-30569383 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
1178384551 21:32138576-32138598 TGTCCTTGCGATAAGGCAGAGGG + Intergenic
1178422335 21:32452573-32452595 TGTCTTTGTGATAAGGCAGAGGG - Intronic
1178438697 21:32581415-32581437 TGTCCTTGTGATAAGGCAGAGGG + Intronic
1179010883 21:37555186-37555208 TATACTCGGGATAAGGCGATTGG + Intergenic
1183329866 22:37213595-37213617 TGTCCCGGGCACAAGGCAAAGGG - Intergenic
949806238 3:7958953-7958975 TGTCCTTGCGATAAGGCAGAAGG - Intergenic
949808236 3:7978333-7978355 TGTCCTTGTGATAAGACAGAGGG - Intergenic
951706857 3:25552373-25552395 TGTTCTCAGGATAATGAAAATGG + Intronic
952002959 3:28808469-28808491 TGTCCTTGAGAAAACGCAAAGGG - Intergenic
952564188 3:34635276-34635298 TGTCATTGTGATAAGGCAAAGGG - Intergenic
956216936 3:66858675-66858697 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
956509920 3:69982173-69982195 TGTCCTCTGATTAAGGCCAATGG + Intergenic
956511711 3:70000069-70000091 TGTCCTTGCGATAAGGTAGAGGG + Intergenic
956735250 3:72233115-72233137 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
956982475 3:74654704-74654726 TGTCCTTGTGATAAAGCAAAGGG + Intergenic
957048172 3:75392531-75392553 TGTCTTTGTGATAAGGCAGAGGG + Intergenic
957479212 3:80769990-80770012 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
957758434 3:84522901-84522923 TGTCCTTGCGATAAGGCAGAGGG + Intergenic
958663735 3:97106652-97106674 TGTCCTTGTGATAAGGCAGAGGG + Intronic
958978839 3:100697215-100697237 TGCCCTGGCGATAAGGCAGAGGG + Intergenic
959419969 3:106117111-106117133 TGTCCTTGTGACAAGGCAGAGGG - Intergenic
959583461 3:108004593-108004615 TGTCCTTGTGATAAGGCAGGGGG + Intergenic
960501586 3:118444909-118444931 TGTCCTTGCGATAAGGCAGAAGG - Intergenic
960515205 3:118595634-118595656 TGTCCTTGTGATAAGGCAGGGGG - Intergenic
961880245 3:130056633-130056655 TGTCTTTGTGATAAGGCAGAGGG + Intergenic
968992633 4:3924988-3925010 TGTCTTTGTGATAAGGCAGAGGG + Intergenic
970163619 4:13213908-13213930 TGTCCTCTAGATAAAGAAAAGGG - Intergenic
970233368 4:13933603-13933625 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
971831538 4:31701761-31701783 TGTCCTTGCAATAAGGCAGAAGG + Intergenic
972614101 4:40681604-40681626 TGTCCATTGGATTAGGCAAAAGG + Intergenic
972940227 4:44186470-44186492 TGTCCTTGCGATAAGGCAGAGGG + Intronic
974166814 4:58214739-58214761 TGTCCTTGCTATAAGGCAGAGGG - Intergenic
974250073 4:59374765-59374787 TGTCCTTGTGATAAGGCAGGGGG - Intergenic
974962804 4:68724712-68724734 TGCCCTTGAGATAAGGCAGAGGG - Intergenic
977045173 4:92060657-92060679 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
979859548 4:125676604-125676626 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
980330756 4:131408453-131408475 TGTCCTTGCGATTAGGCAAGGGG - Intergenic
980337889 4:131499877-131499899 TGTCCTTGCGATAAGGCAGAGGG - Intergenic
980438331 4:132809679-132809701 TGTCCTTGGGATAAGGCAGAGGG + Intergenic
980485469 4:133451271-133451293 TGTCCTTGTGATAAGGCAGGGGG + Intergenic
980496857 4:133596737-133596759 TGCCCTCGTGATAAGGCAGAGGG - Intergenic
980682594 4:136183872-136183894 TGTCCTTGGGGTAAGGCAGGGGG - Intergenic
980731616 4:136831918-136831940 TGTCCTTGTGATATGGCAGAGGG - Intergenic
981423829 4:144581226-144581248 TGTCCTTGTGATAAGACAGAAGG + Intergenic
982474656 4:155835124-155835146 TGCCCTTGCGATAAGGCAGAGGG + Intronic
983588540 4:169382602-169382624 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
984081707 4:175255293-175255315 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
984898509 4:184563648-184563670 TGGCCTTGAGCTAAGGCAAAGGG - Intergenic
985228171 4:187784817-187784839 TGTCCTTGCCATAAGGCAGAGGG + Intergenic
985854876 5:2416938-2416960 TGTCCCTGCCATAAGGCAAAGGG + Intergenic
986159931 5:5218568-5218590 TGCCCTTGGAATAAGGCACAGGG - Intronic
986165247 5:5267305-5267327 TGTCCTCGGGATAAGGCAAAGGG - Intronic
986918178 5:12650692-12650714 TGTCCTGGGTATAAGGAGAAAGG - Intergenic
987525842 5:19047848-19047870 TGACCACGGGAAAAGGGAAAAGG - Intergenic
988038437 5:25858045-25858067 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
988205363 5:28126655-28126677 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
988267252 5:28967846-28967868 TGTCCTTGCGATAAGGCAGGGGG + Intergenic
988566552 5:32323784-32323806 TGTCTTCGCGGTAAGGCAGAGGG + Intergenic
989491471 5:42060412-42060434 TGCCCTCGCGATAAGGCAGAGGG + Intergenic
992210799 5:74477982-74478004 TGCCCTAGCGATAAGGCAGAGGG - Intergenic
993302102 5:86224018-86224040 TGTTCTTGTGATAAGGCAGAGGG + Intergenic
994661677 5:102661378-102661400 TGTCCTTGTGGTAAGGCAGAGGG + Intergenic
995717862 5:115097776-115097798 TGTCTTAGGTATCAGGCAAATGG - Intergenic
999536976 5:152528540-152528562 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1001843460 5:174901100-174901122 TCTGCTCAGGATCAGGCAAAGGG + Intergenic
1002411755 5:179084714-179084736 TGTCCTCACGATAAGGCAACTGG - Intergenic
1002475686 5:179464441-179464463 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1002962250 6:1926220-1926242 TGTCCTGGAGATAAGGAAAGGGG + Intronic
1003415701 6:5905969-5905991 TGTCCTCAAGACAAGGCAACCGG + Intergenic
1003499762 6:6694705-6694727 TGTCCTTGGAATAAGGCAGGAGG - Intergenic
1004176639 6:13345873-13345895 TGTCCTGGTGATGAGGCAAAGGG - Intergenic
1004746215 6:18511357-18511379 TGTCCTTGTGATAAAGCAGAGGG + Intergenic
1005122870 6:22409974-22409996 TGTCCTTGGGATAAGGGGCAGGG - Intergenic
1005461211 6:26071688-26071710 TGTCCTTGGGACAAGGTAGACGG + Intergenic
1006208953 6:32376180-32376202 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1006731041 6:36236284-36236306 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
1006756565 6:36421121-36421143 TGTTCTTAGGATAAAGCAAATGG + Intronic
1009792633 6:68422717-68422739 TTTCCTTTGGATATGGCAAATGG + Intergenic
1010014316 6:71086605-71086627 TGTCCTTGAAATAAGGCAAAGGG + Intergenic
1010028344 6:71245601-71245623 TGTCCTTTCGATAAGGCAGAGGG - Intergenic
1010519063 6:76810313-76810335 TGCCCTTGCGATAAGGCAAAGGG + Intergenic
1010768186 6:79799762-79799784 TGTGCTTAGGATAATGCAAAAGG - Intergenic
1012610694 6:101215501-101215523 TTTCTTCAGGATAATGCAAAAGG - Intergenic
1013343345 6:109236666-109236688 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1013965956 6:115955428-115955450 TGTCCTGGGAATAAGGCAAAAGG + Intronic
1014867541 6:126550706-126550728 TGCCCTTGCGATAAGGCAGAAGG - Intergenic
1016557226 6:145352662-145352684 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
1017948523 6:159116329-159116351 TGCCCTTGCGATAAGGCAGAGGG + Intergenic
1019046966 6:169156749-169156771 TGTGCTCAGAATATGGCAAAAGG + Intergenic
1019800589 7:3085289-3085311 TGTCCTTGCGATAAGGCAGAGGG + Intergenic
1020315283 7:6901344-6901366 TGTCTTTGTGATAAGGCAGAGGG + Intergenic
1021820679 7:24494781-24494803 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1024777398 7:52803513-52803535 TGTCCTGAGGATAAGGAAAGGGG - Intergenic
1026111040 7:67459161-67459183 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
1026313954 7:69211824-69211846 TGTCCTTGCGATAAGGCAGAGGG + Intergenic
1026557754 7:71422750-71422772 TGTCCTTGTGATAAGGCAGAGGG - Intronic
1028828217 7:95298874-95298896 GGTCCTCGGAATATGGCAAGCGG + Exonic
1029611577 7:101629426-101629448 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
1029914172 7:104189517-104189539 TGTCCTTGGGAAAAGGAGAAGGG + Intronic
1030207665 7:106966658-106966680 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1030513581 7:110515337-110515359 TGCCCTTGTGATAAGGCAGAGGG - Intergenic
1030746583 7:113173179-113173201 TGTCCTGGTGATAAGGCAGAGGG + Intergenic
1031232328 7:119123784-119123806 TGTCCTTGTGATAAGGCAGAGGG + Intergenic
1032316267 7:130841828-130841850 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1032673298 7:134106021-134106043 TGTCTTTGTGATAAGGCACAGGG - Intergenic
1033418480 7:141185240-141185262 TGTCCTGGAGATAAGGCAGGAGG - Intronic
1033852750 7:145517138-145517160 TGTCCTAGGTATTATGCAAAGGG + Intergenic
1034763624 7:153696605-153696627 TGTCCTTGCGATTAGGCAGAGGG + Intergenic
1034931325 7:155166145-155166167 TGTCCTTGCGATAAGCCAGAGGG + Intergenic
1035358842 7:158296499-158296521 TGTCCTTGCAATAAGGCAGAGGG + Intronic
1035523002 8:290465-290487 TGTCCCCAGGAGAAGGCGAAGGG + Intergenic
1037226810 8:16602377-16602399 TGTCCTTGGAATAAGGCAGAAGG + Intergenic
1038044013 8:23750764-23750786 TGTCCTCCTGATAAAGCACATGG + Intergenic
1038862403 8:31401762-31401784 TGTCCTTGCGATAAGGCAAAGGG + Intergenic
1040782141 8:51121930-51121952 TGTCCTTCTGATAAGGCAGAGGG + Intergenic
1041312375 8:56529898-56529920 TGTCCTTGTGATAAGGTAGAGGG + Intergenic
1042077847 8:65015799-65015821 TGCCCTCGCGAAAAGGCAGAGGG - Intergenic
1042159195 8:65874964-65874986 TGTCCTTGCAATAAGGCAGAGGG - Intergenic
1043599833 8:81923724-81923746 TGTCCGTGTGATAAGGCACAGGG + Intergenic
1044765832 8:95572740-95572762 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1046174657 8:110559898-110559920 TGCCCTTGTGATAAGGCAGATGG - Intergenic
1046260907 8:111766154-111766176 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1046439244 8:114236769-114236791 TGTCCTTGCGATAAGGCAAAGGG + Intergenic
1047586549 8:126279832-126279854 TGTCCTTGGGATAAGGCAGAGGG + Intergenic
1048531449 8:135253794-135253816 TGCCCTTGGAATAAGGCAGAGGG + Intergenic
1048623360 8:136159000-136159022 TGTCCTTGAGATAAGGCAGAGGG - Intergenic
1048668897 8:136694904-136694926 TGTCCTTGCCATAAGGCAGAGGG - Intergenic
1048671689 8:136730149-136730171 TGTTCTTGTGATAAGGCAGAGGG - Intergenic
1048899917 8:139027426-139027448 TGCCCTTGTGATAAGGCAGAGGG + Intergenic
1050479322 9:6073530-6073552 TGTCCTTGTGATAAGGAAAGGGG + Intergenic
1055054354 9:72010412-72010434 TGTCCTTGCGATAAGGCAGGGGG - Intergenic
1055979029 9:81983434-81983456 TGTCCTTGGGATAAGCCACTTGG - Intergenic
1056274041 9:84975246-84975268 TGTCCTTGGAATAAGGAAGATGG + Intronic
1056327384 9:85491058-85491080 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1056377473 9:86028578-86028600 TGTCCTTGCGATAAGGCAGAGGG + Intronic
1056871935 9:90289768-90289790 TGTCTTTGTGATAAGGCAGAGGG + Intergenic
1058136526 9:101313824-101313846 TTGCCTGGGGATAAGGGAAAAGG - Intronic
1187568171 X:20473819-20473841 TGTCCTCATGATATGGCAACTGG + Intergenic
1187707841 X:22025299-22025321 TGCCCTTGTGATAAGGCACAGGG - Intergenic
1187885315 X:23883640-23883662 TGTCCTTGCAATAAGGCAGAGGG + Intronic
1188239340 X:27766070-27766092 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1189083921 X:38000639-38000661 TGTCCTTGCGATAAGGCAGTGGG - Intronic
1190766698 X:53481101-53481123 TGTCCTTGGGATAAGGCAAAGGG + Intergenic
1191766569 X:64705011-64705033 TGTCCTTGTGATAAGGCAGAGGG - Intergenic
1192098491 X:68238930-68238952 TCTCCTTGTGATAAGGCAGAGGG - Intronic
1193322061 X:80134204-80134226 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1193358404 X:80551017-80551039 TGTCCTTGCGATAAGGCAGTTGG - Intergenic
1193702447 X:84779779-84779801 TGTCCTTGTGATAAGGAAAGGGG - Intergenic
1193836313 X:86349039-86349061 TGTTCTTGTGATAAGGCAGAGGG - Intronic
1194119493 X:89943151-89943173 TGCCCTTGCGATAAGGCAGAGGG + Intergenic
1195853184 X:109305313-109305335 TGTCCACGTGATGAGGCAAGGGG - Intergenic
1196006672 X:110844044-110844066 TGTCCTTGCGATAAGGCAGAGGG + Intergenic
1196243435 X:113370195-113370217 TGCCCTTGCGATAAGGCAGAGGG - Intergenic
1196258861 X:113554601-113554623 TGTCCTCGTGATAAGGCAGGGGG - Intergenic
1196271448 X:113716484-113716506 TGTCCTTGCAATAAGGCAGAGGG + Intergenic
1196275709 X:113763196-113763218 TGTCCTCTGCACAAGCCAAATGG - Intergenic
1196376672 X:115040413-115040435 TGTCCTTGCGGTAAGGCAGAGGG + Intergenic
1196523039 X:116695963-116695985 TGTCCTTGCAATAAGGCAGAAGG + Intergenic
1196715494 X:118807089-118807111 TGACCTAGGGATTAGGCAAGAGG + Intergenic
1197241525 X:124127558-124127580 TGTCCTTGCGATAAGGCAGAGGG + Intronic
1197734640 X:129841802-129841824 TGTCCCCAGGATGAGGAAAAGGG + Exonic
1198711405 X:139508150-139508172 TGTCATTGCGATAAGGCAGAGGG + Intergenic
1198883437 X:141306654-141306676 TGTCCTTGTAATAAGGCAGAGGG + Intergenic
1199158218 X:144574779-144574801 TGTCTTCCTGAAAAGGCAAAGGG + Intergenic
1200472365 Y:3600708-3600730 TGCCCTTGCGATAAGGCAGAGGG + Intergenic
1201860191 Y:18589127-18589149 TGTACTTGTGATAAGCCAAAAGG - Intergenic
1201873130 Y:18731254-18731276 TGTACTTGTGATAAGCCAAAAGG + Intergenic
1202019967 Y:20453919-20453941 TGTCCTTGCAATAAGGCAGAGGG + Intergenic