ID: 986167314

View in Genome Browser
Species Human (GRCh38)
Location 5:5286114-5286136
Sequence CTAGTTCATCCCATTTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986167314 Original CRISPR CTAGTTCATCCCATTTAAAT GGG (reversed) Intronic
900525856 1:3128343-3128365 CTATTTTATCCCAGTTAAAGTGG + Intronic
901554244 1:10019043-10019065 CTACTTCACCTCATTTACATGGG + Intergenic
905701976 1:40023597-40023619 CCTGTTCATCCCTTTTGAATGGG + Intergenic
906043400 1:42807237-42807259 CTGGTTCCTCCCATCTGAATTGG - Exonic
907256385 1:53182356-53182378 CTAATTCCTATCATTTAAATTGG + Intergenic
907557612 1:55358334-55358356 TTTGTTCTTCCCACTTAAATGGG - Intergenic
911848361 1:102783424-102783446 CTAGTTTCTCCCATTTGAAATGG - Intergenic
911963693 1:104338378-104338400 CAGGTTCATCCCATTGAGATTGG - Intergenic
912980993 1:114372274-114372296 CTATTTCATGCCTTTTAAAAGGG - Intergenic
914866075 1:151430324-151430346 CTAATTCATCCCATGTGAAGAGG + Intronic
915628123 1:157129455-157129477 CTACTTAATTCCTTTTAAATTGG - Intronic
915817858 1:158989072-158989094 CTGGTTCTTCCCTTTTAAAATGG + Intergenic
917916955 1:179711411-179711433 CTAGTTTATTCCTTTTCAATTGG - Intergenic
919493245 1:198231813-198231835 TCAGTTAATCCCATTTAAAAGGG + Intronic
921377384 1:214488504-214488526 CTATTTCATTCCTTTTACATGGG - Intronic
924151342 1:241133343-241133365 CTTATACATCCCATTAAAATGGG - Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1065224573 10:23530318-23530340 TTAGTTTATTCCTTTTAAATTGG - Intergenic
1066742216 10:38528027-38528049 CCATTCCATTCCATTTAAATAGG - Intergenic
1072945502 10:99806425-99806447 CTACTTCAAACCATTGAAATTGG + Intronic
1075642874 10:124077504-124077526 CTCTTTCAGCCCCTTTAAATGGG + Intronic
1077807962 11:5608541-5608563 CCAGTTCATCCCCTTTATTTGGG - Intronic
1079210783 11:18458872-18458894 CCAGTGCATTCCATTTTAATGGG - Intronic
1080990478 11:37528909-37528931 CCAATTCCTCCCATTTAAAATGG - Intergenic
1081673803 11:44956790-44956812 CTAGATTATCTAATTTAAATGGG + Intergenic
1082299585 11:50490033-50490055 CTAATTCTTTCCATTAAAATGGG - Intergenic
1083032640 11:59607552-59607574 TAATTTCATCCCATTTAATTAGG + Intronic
1085749079 11:79144254-79144276 TCATTTCATCCCATTTAAAATGG + Intronic
1087025780 11:93648238-93648260 CTAACTCATCCCATTTATACTGG + Intergenic
1087669046 11:101083716-101083738 CCAGTTACTCCCATTTAAAATGG + Intronic
1089039660 11:115434755-115434777 ATAGTTCATTCCATTTTATTTGG - Intronic
1091524489 12:1284627-1284649 CTATCTCATCCCAGTTAAAATGG - Intronic
1094468029 12:30775040-30775062 CTATTTCATACCCTTTAAAAGGG - Intergenic
1095181181 12:39147946-39147968 CTACTTCACCCCAGTTAAAATGG - Intergenic
1095305373 12:40632432-40632454 CTAGCTCATCAAATTTAAGTTGG + Intergenic
1095838994 12:46671043-46671065 ACAGTTCCTCCCATTTAAAAGGG + Intergenic
1097373546 12:58813753-58813775 ATAGATCATACCATTTTAATTGG + Intergenic
1097472183 12:60008487-60008509 TTAGTTCATGCCATTTAACCAGG + Intergenic
1098777712 12:74642074-74642096 CTATTTCATCACATTAAAACTGG - Intergenic
1100607624 12:96164844-96164866 CAAATTAATCACATTTAAATGGG - Intergenic
1105320970 13:19321866-19321888 CTGTTTCTTCCCAGTTAAATGGG - Intergenic
1105986132 13:25569500-25569522 CTAGTGCATCCCTTTTAAATAGG - Intronic
1106265761 13:28108258-28108280 ATTGTTCATCCCATTTAGATGGG - Intergenic
1106921907 13:34573170-34573192 CTATTTCCTCCCATATAAAATGG - Intergenic
1107643506 13:42469870-42469892 TTATTTCATCCCAGTTAAAATGG + Intergenic
1109801540 13:67385001-67385023 CTAGTTCATTACATTTAAGATGG + Intergenic
1110170623 13:72496323-72496345 CAACATCTTCCCATTTAAATTGG - Intergenic
1112608801 13:100935288-100935310 CCCATCCATCCCATTTAAATAGG - Intergenic
1114608638 14:24019922-24019944 ATAATTCATTCCATTTAAATAGG + Intergenic
1119373804 14:74171548-74171570 CTAGTTCATAACATTTATTTAGG - Intronic
1121774307 14:96580310-96580332 CTAGTGCATCCCAATTAGCTGGG - Intergenic
1122504662 14:102224559-102224581 CTAATTCATCACATTAAATTGGG + Intronic
1124451116 15:29791810-29791832 ATATTTCATCCCAGTTAAAATGG - Intronic
1127823307 15:62679976-62679998 CTAGTTCAGCACATCTATATGGG + Intronic
1133697434 16:8278232-8278254 CTACATCTTCCCATTTTAATTGG + Intergenic
1144008717 17:11125049-11125071 CTTGATCATCCCTTTTAAACAGG - Intergenic
1146367815 17:32242953-32242975 CTCCATCATCCCATTTCAATAGG - Intronic
1151072052 17:71225761-71225783 CAAGTATATTCCATTTAAATAGG - Intergenic
1158075590 18:53524742-53524764 CTAGCCCATCCAATTTACATGGG - Intronic
1159171161 18:64768783-64768805 CTAGTTAATCCACTGTAAATGGG + Intergenic
1166176145 19:41072272-41072294 CTAGTCCATCACAATTAAATAGG - Intergenic
1168469382 19:56628201-56628223 CTAGCTCATCTCATGTAATTTGG - Intergenic
926401447 2:12501129-12501151 CTTGTTCATCACATCTAAAGTGG - Intergenic
926859600 2:17294521-17294543 TTTGTTCATTCCAATTAAATTGG - Intergenic
926966401 2:18418301-18418323 CTGTTTCATCCCATTTAAAATGG - Intergenic
927419371 2:22914124-22914146 CTATTTCACCCCAGTTAAAATGG + Intergenic
927731766 2:25479753-25479775 CTAGTTCCTACCTTTTTAATAGG - Intronic
928050031 2:27982607-27982629 ATATTTTATCCCAATTAAATGGG - Intronic
931021547 2:58050002-58050024 CAAGTTCAAACCCTTTAAATGGG - Intronic
935264008 2:101379272-101379294 CTAGTTCATCCCACCTAGTTAGG - Intronic
938722973 2:134082915-134082937 ATAGTTCATTAAATTTAAATGGG + Intergenic
939015583 2:136899596-136899618 CTTGTTCATTGCATTTTAATGGG + Intronic
939258661 2:139778530-139778552 CAACTTCATCCCATTTAGTTTGG - Intergenic
939644531 2:144680853-144680875 ATAGTTCATCTCATTGAATTAGG + Intergenic
942026014 2:171911747-171911769 ATAGATCATTCCATTTATATAGG + Intronic
948158606 2:235805326-235805348 CTATTTCTTCCCATTTCAAGTGG + Intronic
948739615 2:240034770-240034792 CCATCTCATCCCATTTAAAATGG - Intergenic
1169691495 20:8337573-8337595 CTATTTCATGAAATTTAAATAGG - Intronic
1171239852 20:23557133-23557155 CTAGTCCATCACACTTAAGTAGG - Intergenic
1174502297 20:50994437-50994459 CTAGTTCATCCTCTTTAAAAAGG - Intergenic
1177470073 21:21548943-21548965 CTACTTCAGCCCATTTAAATAGG - Intergenic
951295702 3:20931864-20931886 CCATTTTATTCCATTTAAATGGG + Intergenic
952569837 3:34701374-34701396 CCAATTTATCCCATTTAAAATGG - Intergenic
953576693 3:44118388-44118410 CTAGTTCCTCTCCTTAAAATGGG - Intergenic
954643143 3:52114307-52114329 CCAGTACATCCCATGTAAACCGG + Intronic
956241441 3:67135123-67135145 CTATTTGCTCCCATTTAAATTGG - Intergenic
964275575 3:155005276-155005298 CCAATTTATCCCATTTAAATGGG + Intergenic
964611200 3:158617609-158617631 CTATTTCATGCCCTTTAAAAAGG + Intergenic
966676436 3:182595259-182595281 CTATTTCCTCCCATTAATATTGG + Intergenic
967360782 3:188628897-188628919 CTAATTCAACCCAATCAAATAGG + Intronic
971043166 4:22777535-22777557 CTAGCTCCTGCAATTTAAATGGG + Intergenic
971515732 4:27483738-27483760 CTAGTTCATACCTATTAAAATGG + Intergenic
975935264 4:79572132-79572154 CTATATCATCCCATTTATCTTGG - Intergenic
976353676 4:84089389-84089411 CTATGTTATCCCATTTAAATAGG - Intergenic
978034030 4:103972447-103972469 CTAGTACATCCTATTTAGAGAGG - Intergenic
979184202 4:117768315-117768337 CTAGTTAGTTCCTTTTAAATCGG + Intergenic
979805386 4:124963930-124963952 ATAGTTCTACCCATTGAAATAGG - Intergenic
982448741 4:155526695-155526717 AAAGTTCATCCAATTAAAATAGG + Intergenic
982546973 4:156746096-156746118 CTATTTTATCCCATCTAAATTGG + Intergenic
983130689 4:164015760-164015782 TTATTTCATCCCAGTTAAAATGG + Intronic
984914050 4:184704471-184704493 CTAGTACATGCCATCTAAGTTGG + Intronic
986167314 5:5286114-5286136 CTAGTTCATCCCATTTAAATGGG - Intronic
987780943 5:22434543-22434565 CTATTTTTTCCCAGTTAAATAGG + Intronic
992322802 5:75630165-75630187 CTTTTTCATCACATTCAAATAGG - Intronic
992481310 5:77154791-77154813 CCAGTTCATCCCAGTTTAACTGG - Intergenic
993121139 5:83775472-83775494 CTTGTTAATCCCTTTTAAAATGG + Intergenic
993269430 5:85774881-85774903 CTTGTTCATTTCTTTTAAATTGG - Intergenic
993278929 5:85899310-85899332 AAAGTTTATCACATTTAAATGGG - Intergenic
993415442 5:87624170-87624192 CTAGTTCATCCAATTTGTAATGG + Intergenic
993961954 5:94308867-94308889 ATAGATCATTCCATTGAAATTGG + Intronic
995815401 5:116162004-116162026 AATTTTCATCCCATTTAAATTGG + Intronic
996632777 5:125655942-125655964 TTACTTTATACCATTTAAATTGG + Intergenic
998599170 5:143567432-143567454 CTAGGTTTTCCCATTTATATTGG + Intergenic
999556721 5:152751767-152751789 CTAGTTCATCTCATTGGGATGGG + Intergenic
1000218790 5:159191308-159191330 CTAGTTCATTCCACTTAGGTAGG - Intronic
1000851449 5:166345060-166345082 CTAGTGGATACCATTTAGATTGG + Intergenic
1000941973 5:167372603-167372625 CTATGTAATCCCATTTAAAATGG - Intronic
1003337031 6:5183488-5183510 CAAGTTCATTCCTTTTGAATAGG - Intronic
1005367763 6:25096577-25096599 ATAGTTCATTTTATTTAAATGGG + Intergenic
1006841161 6:37028578-37028600 CCAACTCAGCCCATTTAAATCGG - Exonic
1008245542 6:49167258-49167280 CTACTTCATTCCAGTTAAAATGG - Intergenic
1008369925 6:50720613-50720635 CTATTTTATTCCATTTCAATAGG - Intronic
1013566996 6:111375500-111375522 CTACCTCATCCCATGGAAATTGG - Exonic
1014053323 6:116982930-116982952 CTACTTCATCTCATATTAATGGG + Intergenic
1014260254 6:119208273-119208295 CTACTTCTTCCATTTTAAATTGG + Intronic
1017787184 6:157766206-157766228 CAAGTTCATCCCTTTGAAATGGG - Intronic
1021061974 7:16124237-16124259 CTATTTCATCCCAGTTAGAATGG - Intronic
1023746234 7:43325512-43325534 CTTGTTCATCCAATTTTAGTAGG + Intronic
1030215888 7:107044019-107044041 TTAGTTGATCTCTTTTAAATAGG - Intergenic
1031332803 7:120486894-120486916 ATAGTTCAATTCATTTAAATTGG - Intronic
1032946480 7:136859139-136859161 CCAGTTCATTCCATTGTAATAGG + Intergenic
1033507444 7:142019591-142019613 CAAGTTTATCCCTTTTAAAGTGG + Intronic
1033885667 7:145942273-145942295 TTATTTCATCCCAGTTAAAATGG + Intergenic
1038620604 8:29139335-29139357 CTAGTCCATCACCTTTAAAATGG + Intronic
1039464964 8:37778458-37778480 CTTTTTCATCTCATTTTAATAGG + Exonic
1039669234 8:39578139-39578161 CTACTTTATCCCAATGAAATAGG - Intergenic
1042268593 8:66933958-66933980 CTAGTTCATTCTATTTAATTTGG - Intergenic
1042721359 8:71830233-71830255 TTAGTTCAGCACATATAAATTGG + Intronic
1043211617 8:77526649-77526671 TCAGTTCATACTATTTAAATTGG - Intergenic
1044269066 8:90219037-90219059 CTAGTTTTTCCCTTTTAAAAAGG - Intergenic
1046115295 8:109776979-109777001 CTTGTTCATCTCATTGGAATTGG - Intergenic
1046260946 8:111766419-111766441 CCAGTTCCTCCTATTGAAATGGG - Intergenic
1046875639 8:119251839-119251861 CAAGGTCATCCCATTTGAAGTGG - Intergenic
1048271850 8:133035610-133035632 CTATATCATCCCATTAACATAGG + Intronic
1048426346 8:134327583-134327605 CAATTTCATCCCATGTAAAATGG - Intergenic
1052267354 9:26590170-26590192 CCAGTTCCTCCCATTTCAAATGG - Intergenic
1052493043 9:29190540-29190562 CTAGTTCATATGATTAAAATAGG + Intergenic
1054976698 9:71154873-71154895 GTAGTTTATACCATTTTAATGGG - Intronic
1055225413 9:73989480-73989502 CTAATTCCTCCCATTTATAATGG - Intergenic
1055285956 9:74727957-74727979 AGATTTCATCCCATTTAAGTCGG + Intronic
1056145240 9:83722540-83722562 CTAGTGCCTCCCATGGAAATGGG + Intergenic
1058395585 9:104549936-104549958 TTACTTCATACCATTTTAATTGG - Intergenic
1058638944 9:107064467-107064489 TGAGTTCATCCCATCTAAGTGGG + Intergenic
1061410414 9:130418073-130418095 CTAGTTGATGCCAATGAAATGGG - Intronic
1188688448 X:33099158-33099180 CTATTTATTCCCATTTAGATGGG + Intronic
1189351993 X:40282563-40282585 CTAGTTACTCCCATTTTCATGGG - Intergenic
1193031952 X:76907811-76907833 CTAATTCATCCCAATCAAGTAGG + Intergenic
1193387227 X:80886002-80886024 CAAGTTCTTCCAATTGAAATGGG - Intergenic
1193882752 X:86944660-86944682 TTAGTTAATACAATTTAAATTGG + Intergenic
1194024162 X:88730947-88730969 CTATTTCATTCCAGTTAAAATGG + Intergenic
1196028238 X:111065404-111065426 ATAATTCACCACATTTAAATAGG - Intronic
1198279049 X:135124281-135124303 CTTATTCCTCCCACTTAAATTGG - Intergenic
1198291909 X:135248239-135248261 CTTATTCCTCCCACTTAAATTGG + Intergenic
1198374543 X:136025712-136025734 CTATTTCATCCCTTGTAAAATGG - Intronic
1199159647 X:144593558-144593580 CTATTTCACCCCAGTTAAAATGG - Intergenic
1200780738 Y:7213207-7213229 CTATTTCATCAGATTGAAATAGG - Intergenic
1201396055 Y:13550122-13550144 TTATTTCATCCCAGTTAAAAGGG - Intergenic