ID: 986167488

View in Genome Browser
Species Human (GRCh38)
Location 5:5287923-5287945
Sequence GCATCCAGGTTCGCTGCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 105}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986167483_986167488 12 Left 986167483 5:5287888-5287910 CCTTAGGAACTGTGCGGCTGCAG 0: 1
1: 0
2: 0
3: 5
4: 91
Right 986167488 5:5287923-5287945 GCATCCAGGTTCGCTGCAGGAGG 0: 1
1: 0
2: 0
3: 7
4: 105

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986167488 Original CRISPR GCATCCAGGTTCGCTGCAGG AGG Intronic
901183657 1:7358519-7358541 GCATGCAGGGACGCTGGAGGAGG - Intronic
912347031 1:108973213-108973235 GCATCTTGGCTCACTGCAGGGGG - Intronic
915355802 1:155254784-155254806 GCAGCCAGGGTCGGTGGAGGCGG + Exonic
919555304 1:199045863-199045885 GCATTCAGGTACCCTGCATGGGG - Intergenic
919924725 1:202186403-202186425 CCATCCTGGTGCACTGCAGGAGG + Intergenic
923093380 1:230755955-230755977 GCACTCAGGTTCATTGCAGGAGG - Intronic
924074579 1:240320064-240320086 GCATCCAGGTTAGCAGCAACTGG + Intronic
924623693 1:245683784-245683806 TAATCCAGGTTCGTGGCAGGGGG + Intronic
1062857667 10:787363-787385 GCTGCCAGGTCCTCTGCAGGCGG + Intergenic
1067344678 10:45428757-45428779 CCATCCAGGTAGGCTGCTGGGGG + Exonic
1076380012 10:130018468-130018490 TCATCCAGCTGGGCTGCAGGGGG - Intergenic
1076530835 10:131143251-131143273 GCACCCAGGGTCCCTGCAGGCGG + Intronic
1076567204 10:131406962-131406984 CCATCCAGGCTCTCTCCAGGTGG - Intergenic
1081153787 11:39664263-39664285 GGACCCAGGCTTGCTGCAGGAGG - Intergenic
1082077110 11:47982238-47982260 ACTCCCAGGTTCTCTGCAGGAGG - Intronic
1083234271 11:61341844-61341866 GGAACCAGGGACGCTGCAGGAGG - Exonic
1084083481 11:66843854-66843876 GCATCCAGGTGCGAAGGAGGCGG + Exonic
1084701743 11:70790810-70790832 GCATCCAGGTTCCCTCCACAGGG + Intronic
1090281778 11:125462641-125462663 ACATTCATGTTCACTGCAGGTGG + Intronic
1102430441 12:112879109-112879131 GCACCCAGGGTGGCTGAAGGGGG - Exonic
1102908111 12:116693027-116693049 GCATCCAGTTGAGGTGCAGGAGG + Intergenic
1103465236 12:121137146-121137168 GCAACCGGGTTCGCTGGAGTAGG + Intronic
1104278844 12:127355233-127355255 CCATCCAGCTTGGCTGCAGTAGG - Intergenic
1104518810 12:129453673-129453695 GGATCCAAGTTCACTGAAGGTGG - Intronic
1105241143 13:18610354-18610376 GCATGCAGCGTCCCTGCAGGAGG + Intergenic
1117594035 14:57307938-57307960 TCATCAAGGTACACTGCAGGAGG - Intergenic
1122249517 14:100428068-100428090 GAAGCCAGGTTCCCTGCAGCAGG + Intronic
1123490211 15:20774793-20774815 GCATGCAGCGTCCCTGCAGGAGG - Intergenic
1123546712 15:21343880-21343902 GCATGCAGCGTCCCTGCAGGAGG - Intergenic
1124404989 15:29384466-29384488 GCATCCAGGATGGCTTCAGTGGG - Intronic
1126468926 15:48986141-48986163 GCATCCAGGCTTGCTTCTGGTGG + Intergenic
1128457332 15:67839001-67839023 GCCTCCAGGCGCGCCGCAGGAGG - Intergenic
1130824316 15:87528168-87528190 GCACCCAGGTTCAATGGAGGAGG + Intergenic
1202955043 15_KI270727v1_random:71095-71117 GCATGCAGCGTCCCTGCAGGAGG - Intergenic
1140506047 16:75473455-75473477 GCACGCAGGTTCTCTTCAGGTGG + Exonic
1140513467 16:75525211-75525233 GCACACAGGTTCTCTTCAGGTGG + Intergenic
1142219806 16:88848597-88848619 GCATCCTGGTTTTCTGCAGATGG + Intronic
1142672830 17:1495107-1495129 GGATCCAGGTTCGCTTCCGTTGG - Exonic
1142851746 17:2707831-2707853 GCAGCCAGGTCACCTGCAGGGGG - Intronic
1142899753 17:3004591-3004613 GCCTCGAGGTTCGCTGCATGGGG - Intronic
1143921990 17:10337338-10337360 GGCTCCAGGTTTGCTGCAAGAGG + Intronic
1147888110 17:43698197-43698219 GCATCCAGCTTGGCTGGCGGTGG + Intergenic
1150264973 17:63826483-63826505 GCTTCCAGTTTCACTGCGGGAGG - Intronic
1152369118 17:79874598-79874620 GCTTCCACATTCACTGCAGGTGG - Intergenic
1152751456 17:82064331-82064353 GGGCCCAGGTTCACTGCAGGAGG + Intronic
1154447815 18:14449547-14449569 GCATGCAGCGTCCCTGCAGGAGG - Intergenic
1157285219 18:46372978-46373000 GCTTCCAGTTTCCCAGCAGGAGG - Intronic
1157555915 18:48612803-48612825 GAACCCAGGCCCGCTGCAGGGGG - Intronic
1161844211 19:6702567-6702589 TCATCCAGGTTACCTGCAGGGGG + Exonic
1163015531 19:14451819-14451841 ACCTCCAGGGTCCCTGCAGGAGG - Exonic
1168064744 19:53912726-53912748 GCATCCCGGGTTGCTGCATGGGG + Intronic
925208406 2:2026634-2026656 AGGTCAAGGTTCGCTGCAGGAGG + Intronic
926592527 2:14755012-14755034 GAATTCAGGTTCATTGCAGGTGG + Intergenic
934924923 2:98375468-98375490 GCACCTAGGTTGGTTGCAGGAGG - Intronic
935128914 2:100246951-100246973 GCACCCAGGTTCTCAGGAGGCGG - Intergenic
935925502 2:108064622-108064644 GCAACTAGTTTGGCTGCAGGTGG - Intergenic
936007947 2:108906839-108906861 GCTTCCAGGGTCTCTGCAAGTGG + Intronic
936340783 2:111630874-111630896 GTAACCGGGTTCCCTGCAGGTGG - Intergenic
938548209 2:132353583-132353605 GCATCCCCGGTGGCTGCAGGCGG + Intergenic
938759101 2:134407685-134407707 GCATACAGGTATGCTGGAGGAGG + Intronic
941730613 2:168913095-168913117 GGATCTGGGTGCGCTGCAGGGGG + Intronic
948570454 2:238914196-238914218 GCATCCTGCTTCTCTGTAGGCGG + Intergenic
1169159929 20:3368845-3368867 TCATCCAGGCTGGGTGCAGGTGG + Intronic
1173217230 20:41096436-41096458 GCATCCTGGTTCCCTGAAAGAGG + Intronic
1173607413 20:44341436-44341458 GAATGCAGGCTCCCTGCAGGTGG - Intronic
1175809411 20:61849684-61849706 GCATGCAGGTGCCCTTCAGGGGG - Intronic
1176227718 20:64011496-64011518 GGATCCAGGTGGGCCGCAGGCGG + Exonic
1176448392 21:6841118-6841140 GCATCGAGCGTCCCTGCAGGAGG + Intergenic
1176826562 21:13706140-13706162 GCATCGAGCGTCCCTGCAGGAGG + Intergenic
1177147612 21:17423341-17423363 GCATCCAGGTAAGCTGCAGCTGG + Intergenic
1178790643 21:35696890-35696912 TAAGCCAGGGTCGCTGCAGGTGG + Intronic
1181147292 22:20858334-20858356 GCCTGCAGGGCCGCTGCAGGTGG - Intronic
1184220910 22:43099237-43099259 CCAGCCAAGTTGGCTGCAGGGGG - Intergenic
1185085402 22:48738100-48738122 GCAGCCAGGCTCACTGCAGCAGG - Intronic
953205713 3:40827014-40827036 ACATCCAGGTTCATTCCAGGCGG + Intergenic
954377710 3:50203810-50203832 GCATCCAGGGTGTCTGCAAGTGG + Intergenic
962893679 3:139695154-139695176 GCAACCAGGTTTTCTGCTGGAGG + Intergenic
966162780 3:176985543-176985565 ACATCCAGATTTGGTGCAGGTGG - Intergenic
968058072 3:195708292-195708314 GCATCCAGCTTTGCTGTAGGTGG - Intergenic
973892970 4:55386355-55386377 GCATCCAAGTTCCCAGCAGAAGG - Intergenic
982131219 4:152230431-152230453 GGAACCAGGTTTGCTGCAGGGGG - Intergenic
986167488 5:5287923-5287945 GCATCCAGGTTCGCTGCAGGAGG + Intronic
993176047 5:84487086-84487108 TCATCCAGGTTAGCTGAAGAGGG - Intergenic
995018147 5:107336038-107336060 GCATCCAGGTTTTCTGGTGGTGG - Intergenic
997698565 5:135880449-135880471 GCAACCAGGGTACCTGCAGGGGG + Intronic
999381901 5:151127186-151127208 GCATCCAGGCACTTTGCAGGAGG - Intronic
1001122410 5:168991553-168991575 GCCTACAGGTTTGCTGCTGGGGG - Intronic
1007076717 6:39073025-39073047 GCATCCAGGACCGCCTCAGGAGG + Intronic
1011483018 6:87814033-87814055 GAATCCAGGATGGCTGCTGGGGG + Intergenic
1012194391 6:96321556-96321578 GCTTCCCGGTTTGCTGCAGTAGG + Intergenic
1013922238 6:115420010-115420032 GCGTTCAGGTTTGATGCAGGTGG - Intergenic
1022796368 7:33734710-33734732 GCATCCAGGATTGCAGGAGGAGG - Intergenic
1023599196 7:41864974-41864996 GGCTCCAGGTTTGCTGCAGGAGG + Intergenic
1024243857 7:47455009-47455031 GTTTCCAGGCTCTCTGCAGGGGG - Intronic
1032237899 7:130140786-130140808 CCAGCCATGTGCGCTGCAGGCGG - Intergenic
1033115167 7:138618882-138618904 GAATCCAGGTGGGCTACAGGAGG + Intronic
1033587294 7:142783499-142783521 GCATCCATGTGGGCAGCAGGGGG - Intergenic
1034338524 7:150338406-150338428 GCCTCCAGGACCGCTGCGGGTGG - Exonic
1035041040 7:155927359-155927381 GCTCCCAGGGTCCCTGCAGGAGG - Intergenic
1036020739 8:4842591-4842613 GCACCCGGGTTCCCTGCAGCAGG - Intronic
1038693324 8:29782799-29782821 GCAGCCAGCTCAGCTGCAGGAGG - Intergenic
1041643661 8:60229510-60229532 TCATCCAGGGTGGCAGCAGGAGG - Intronic
1049510713 8:143025444-143025466 GCTTCAAGGTTCCCTGAAGGGGG - Intergenic
1049511449 8:143028716-143028738 GCTTCAAGGTTCCCTGAAGGGGG - Intergenic
1056788825 9:89612130-89612152 GCATCCAGGTGAGAAGCAGGTGG - Intergenic
1057039921 9:91840542-91840564 GGATCCAGCCTCGCTGCATGTGG - Intronic
1061792188 9:133064630-133064652 GCCTTCAGGGTCCCTGCAGGTGG - Exonic
1203520799 Un_GL000213v1:43400-43422 GCATCGAGCGTCCCTGCAGGAGG - Intergenic
1203654956 Un_KI270752v1:14809-14831 ACATCCAGGTTCCTTTCAGGAGG + Intergenic
1185818181 X:3175880-3175902 TCATCCTGCTTCGCTGTAGGTGG - Intergenic
1188027763 X:25228688-25228710 GAATCCTGGTTCGCTGTTGGTGG + Intergenic
1197665982 X:129224008-129224030 TCATCTAGGTTGGCTGCAGCTGG + Intergenic
1198921618 X:141734977-141734999 GCATCCAGGTTCTCCACATGAGG + Intergenic