ID: 986169827

View in Genome Browser
Species Human (GRCh38)
Location 5:5306611-5306633
Sequence GCCGAAGCCCAGCCTGGAGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 383
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 348}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986169825_986169827 -1 Left 986169825 5:5306589-5306611 CCTCAAAGAAGTGCTCACATTTG 0: 1
1: 0
2: 0
3: 10
4: 229
Right 986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG 0: 1
1: 0
2: 2
3: 32
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986169827 Original CRISPR GCCGAAGCCCAGCCTGGAGC TGG Exonic
900393371 1:2443417-2443439 GCAAACGCCCAGCCTGGAGATGG + Intronic
900409629 1:2506855-2506877 GCCGAAGCCGGAGCTGGAGCAGG - Intergenic
900952332 1:5865046-5865068 CCCCAACCCCAGCCTGGAGACGG - Intronic
901070202 1:6513175-6513197 GCCCAGGCCCAGCCTGGCCCAGG + Intronic
901180945 1:7341542-7341564 GCTGTCACCCAGCCTGGAGCTGG + Intronic
901930078 1:12591526-12591548 GCGGACGTCCAGCCTGGAACTGG + Intronic
901971436 1:12912075-12912097 GCAGAAGCCCAGGGAGGAGCTGG + Intronic
902013732 1:13289665-13289687 GCAGAAGCCCAGGGAGGAGCTGG - Intergenic
902138853 1:14334665-14334687 GCCCCAGCCCAGCCTTCAGCTGG - Intergenic
902778173 1:18687821-18687843 ACCGAAGCCCAGACTGGGGAAGG - Intronic
902807107 1:18868020-18868042 CCCGATGCACATCCTGGAGCAGG + Intronic
902916683 1:19644096-19644118 GCCGAAGCTCAGCCCGGGGCGGG + Intronic
903353801 1:22734092-22734114 GCCCAAGCCCAGGCTGGCCCTGG - Intronic
903580632 1:24368033-24368055 GCCGCATGCCAGCCTGGAGGCGG + Intronic
904008088 1:27374221-27374243 CCGGGTGCCCAGCCTGGAGCTGG + Intronic
904038687 1:27572038-27572060 GCTGAAGGCCAGGCTGGTGCAGG - Intronic
904334164 1:29786274-29786296 GCCCAAGGCCAGGCTGAAGCAGG - Intergenic
904683938 1:32247593-32247615 GCCCAAGCCAAACCTGGACCAGG + Exonic
905730971 1:40299487-40299509 GCTGAAGCCAAGCCTTGGGCAGG - Intergenic
905796833 1:40820541-40820563 GGCGGAGCCCAGACAGGAGCTGG + Intronic
905919851 1:41712137-41712159 CACGGAGCACAGCCTGGAGCAGG - Intronic
906658660 1:47567036-47567058 GCCGATGTCCAGCCTTGGGCTGG + Intergenic
907237728 1:53063075-53063097 GCCACAGCCCGGCCTGGGGCGGG + Intronic
907323657 1:53621270-53621292 CCCCCAGCCCAGCCAGGAGCAGG + Intronic
907581267 1:55574778-55574800 GCCAGGGCCCAGCCTGCAGCAGG + Intergenic
908035257 1:60044627-60044649 TCTGAAGCCCAGCCTGCAGCTGG - Intronic
912993389 1:114510760-114510782 GCGGGAGCCGAGGCTGGAGCTGG + Exonic
915587330 1:156851396-156851418 GCTGCAGCACAGCCTGGGGCTGG - Exonic
916432595 1:164745653-164745675 GCTTTAGCCCAGCCTGTAGCTGG - Intronic
919253994 1:195097386-195097408 GCCGCAGCCTTGCATGGAGCAGG + Intergenic
919518012 1:198550969-198550991 GTAGAAGAACAGCCTGGAGCAGG + Intergenic
919989658 1:202700383-202700405 GGTGAAGCCCAGCCCAGAGCCGG - Intronic
920037534 1:203075783-203075805 GCCGAGGCCCAGCCGAGCGCGGG + Intronic
920199871 1:204252956-204252978 GCCGCAGCACAGGCGGGAGCAGG - Intronic
920219884 1:204389226-204389248 GCTGTTGCCCAGGCTGGAGCTGG + Intergenic
920244713 1:204578992-204579014 GCTCCAGCCCAGCCTGGATCAGG + Intergenic
920776497 1:208943261-208943283 ACTGAAGCCCAGCTTGGACCAGG + Intergenic
1063450547 10:6147409-6147431 GCAGAAGCACAGCCTGGGGAGGG - Intronic
1063709058 10:8459370-8459392 GGCCCAGCCCAGCATGGAGCGGG - Intergenic
1064259738 10:13775696-13775718 GACCAAGTCCAGGCTGGAGCAGG + Intronic
1064332256 10:14404993-14405015 TCCCATGCCCAGCCTAGAGCAGG + Intronic
1065605587 10:27414214-27414236 GCCCAAGCCCAGGCCGGGGCCGG - Exonic
1067344005 10:45425102-45425124 GCGGCAGCTCAGCTTGGAGCAGG + Exonic
1067521779 10:47013205-47013227 TTCTAAGCCCAGCCTGGTGCTGG - Intergenic
1067849379 10:49745109-49745131 GGGGAAGTCCAGCCTTGAGCAGG - Intronic
1069660920 10:70122982-70123004 CCCCAAGCCCTGCCTGGTGCTGG - Intronic
1070330000 10:75409716-75409738 GGCGGAGCCTGGCCTGGAGCGGG - Intergenic
1072215112 10:93281349-93281371 GCCTGACCCCAACCTGGAGCTGG - Intergenic
1073101083 10:101007063-101007085 GCAGCAGCTCAGCCTGGAGCTGG + Exonic
1073477454 10:103763605-103763627 GCAGAAGCAGAGCCTTGAGCTGG + Intronic
1073481519 10:103788950-103788972 GCTGAGGTCCAGCCTGGGGCGGG + Intronic
1075112269 10:119596857-119596879 GCCGAAGCCCAGCCAGCTCCGGG + Intronic
1075557764 10:123445683-123445705 GCCCCAGCTCAGCCTAGAGCGGG + Intergenic
1076373515 10:129969103-129969125 GCCGCTGCGCAGCCGGGAGCCGG + Intergenic
1076441541 10:130484300-130484322 CCCGATGCCCAGCCTGGAAAGGG - Intergenic
1076543169 10:131227213-131227235 GCCGAAGCCCAACCCAGTGCTGG + Intronic
1076652159 10:131997213-131997235 GGCAGAGCCCAGGCTGGAGCAGG + Intergenic
1076679246 10:132163202-132163224 GCCCCAGCACATCCTGGAGCTGG + Exonic
1076732723 10:132446559-132446581 GGCGAGGCCCAGCCTTGAGCCGG + Intronic
1076777876 10:132708086-132708108 GCTGATGCCCAGCCTGGGGTGGG - Intronic
1077026038 11:440412-440434 GCCCAGATCCAGCCTGGAGCTGG + Intronic
1077034370 11:487717-487739 GCCCAAGCCCAGGCAGGGGCGGG - Intronic
1077137149 11:1006185-1006207 GCTGTAGCCCAGCCTGCAGACGG + Intronic
1077286151 11:1766897-1766919 GCCCACGGCCAGCCTGGACCTGG + Intergenic
1077493731 11:2874800-2874822 ACTGGAGCCCAGCTTGGAGCAGG - Intergenic
1078667456 11:13338655-13338677 GCAGAGTCCCAGCCTGGAGGTGG + Intronic
1079095610 11:17508180-17508202 CCCAGAGCCCAGCCAGGAGCTGG - Intronic
1080276039 11:30504448-30504470 GCCTGAGTCCAGCCTGGAGGTGG + Intronic
1080584374 11:33667968-33667990 CCTGCACCCCAGCCTGGAGCAGG + Exonic
1080614962 11:33937737-33937759 CTCCAAGCCCAGGCTGGAGCAGG - Intergenic
1081153771 11:39664187-39664209 TCCTATGCCCAGCCTGCAGCGGG - Intergenic
1081616812 11:44596162-44596184 GCCCAAGCCCGGCCTGGGGTGGG - Intronic
1083613826 11:64016825-64016847 GCCGAAGCCGGAGCTGGAGCTGG + Intronic
1083916208 11:65745185-65745207 GCCGCAGCCTCGCATGGAGCCGG + Intergenic
1084066086 11:66705166-66705188 CCTGAAGCTCACCCTGGAGCAGG - Exonic
1084540906 11:69786524-69786546 GCCAGATCCCTGCCTGGAGCTGG + Intergenic
1084611599 11:70206637-70206659 GCCCAAGCCCGGCCTGGTGCGGG - Exonic
1085642500 11:78201197-78201219 GCCCTAGCCCAGCCTGGTGGAGG - Intronic
1088083637 11:105951247-105951269 GCAGATGCCCTGCCTGGACCAGG - Intronic
1089560203 11:119339934-119339956 GCCGAAGCTCAGGCAGGGGCGGG - Intronic
1089750457 11:120647892-120647914 GCCAGTGCCCAGCATGGAGCTGG + Intronic
1092159964 12:6310729-6310751 CCCGATGCCCAGCCTGGGACTGG - Intronic
1092165464 12:6339951-6339973 ACAGAAGCCTGGCCTGGAGCTGG - Intronic
1092242054 12:6841203-6841225 GCAGAAGCACAGCCTGGTGGGGG + Intronic
1092758685 12:11789454-11789476 GCTGAAGCCCAGACCGAAGCAGG - Intronic
1096503445 12:52079384-52079406 GCAGCACCCCAGCCTGCAGCTGG + Intergenic
1096771635 12:53939250-53939272 GCCGTAGCCCAGGGTGGCGCTGG - Exonic
1097195453 12:57240292-57240314 CCCCAAGCCCGGCCAGGAGCCGG - Intronic
1097721837 12:63030057-63030079 GCCGAGGACCAGCCAGGAGGGGG - Intergenic
1100679829 12:96907247-96907269 CCGGAAGCCCAGCGCGGAGCCGG + Intronic
1101426573 12:104593157-104593179 CCCGACGCCCAGCCTGTAGAAGG - Intronic
1101874619 12:108590069-108590091 TCTGACGCCCAGCCTGGAGCAGG - Exonic
1102001684 12:109561479-109561501 GGCGGGGCCCATCCTGGAGCTGG - Exonic
1102257938 12:111426955-111426977 GGCCCAGCCCAGCCTGGAGCTGG - Intronic
1102874117 12:116436609-116436631 GCCCATGCCCGGCCTGCAGCAGG + Intergenic
1103324658 12:120112341-120112363 GCCATAGCCCAGGCAGGAGCAGG - Intronic
1103381393 12:120496572-120496594 GCCGATACGCAGCCGGGAGCAGG + Intronic
1103446495 12:120998443-120998465 GGCGAAACCCAGCCTGAACCTGG - Intronic
1103521082 12:121537406-121537428 GCCGAGGCCCAGGCGGAAGCCGG - Intronic
1103685725 12:122730584-122730606 GGAGAGGCCAAGCCTGGAGCCGG + Exonic
1104940642 12:132392987-132393009 GTCGTAGACCAGGCTGGAGCCGG - Intergenic
1105357121 13:19668950-19668972 GCCGCAGCCCTGCCTGGAGAGGG - Intronic
1105427336 13:20305607-20305629 GCTGAGTCCCAGCCTGGGGCAGG + Intergenic
1105554186 13:21430275-21430297 GCAGAAGCCTAGCAGGGAGCTGG - Intronic
1105827730 13:24137304-24137326 GCAAAGGCCCAGCCAGGAGCAGG - Intronic
1106133019 13:26954911-26954933 GCCCCAGCCATGCCTGGAGCTGG + Intergenic
1106424191 13:29610347-29610369 GCAGAATGTCAGCCTGGAGCAGG + Intergenic
1108688761 13:52844860-52844882 GCTGGAGCCCATCCTGCAGCGGG - Exonic
1108710631 13:53028979-53029001 GCTGGAGCCCGACCTGGAGCTGG - Exonic
1110558365 13:76885605-76885627 GCCGTCGCCCACGCTGGAGCTGG - Exonic
1110680565 13:78307183-78307205 GGAGAAGACCAGCCTGGTGCTGG - Intergenic
1111360373 13:87168103-87168125 GCCACAGGCCAGCCTGGAGAAGG + Intergenic
1112229008 13:97569052-97569074 CTGGAAGCCCAGCCTGGGGCTGG + Intergenic
1113661356 13:112108239-112108261 GCCCAGGCCCAGCCAGGGGCTGG - Intergenic
1121127824 14:91418728-91418750 GGCCGAGACCAGCCTGGAGCCGG - Intergenic
1121145431 14:91578253-91578275 GCCGGAGCCCACCATGGGGCGGG - Intergenic
1121629872 14:95414180-95414202 CCCAAAGCCCAGGCTGGAGGGGG - Intronic
1121691034 14:95877105-95877127 GCCGCAGCCCGGCCCGGACCCGG - Intergenic
1122082403 14:99274678-99274700 GCCCCTGCCCAGCCTTGAGCCGG + Intergenic
1123019049 14:105389063-105389085 GCCCAAGCCCAGGCTGCAGTGGG + Intronic
1124131198 15:26987263-26987285 GCCGAAGCACTGTGTGGAGCTGG - Intronic
1124353707 15:28979157-28979179 CCCGAGGCCCAGCCTGGAATCGG - Intronic
1125516247 15:40323044-40323066 TCCGAAGCCCAGCCTGGACTGGG + Intergenic
1125752210 15:42036694-42036716 GCCGGGGCCCAGCCAGGACCTGG + Intronic
1128875066 15:71194963-71194985 TCCGAAGCCCAGCACGGGGCTGG + Intronic
1129252885 15:74318495-74318517 GACCAAGCCCAGCCCTGAGCTGG - Intronic
1129271514 15:74421631-74421653 GCGGGAGCCCAGGCTGGGGCTGG - Intronic
1129718105 15:77863484-77863506 CCATAAGCCCAGCCTGGTGCTGG + Intergenic
1130460810 15:84157287-84157309 CCATAAGCCCAGCCTGGTGCTGG - Intergenic
1131608694 15:93937956-93937978 GCGGAATCCCAGCCTGAAACAGG + Intergenic
1132081005 15:98865518-98865540 GCCGAAGCCCAGCGTGGCCTGGG - Intronic
1132271096 15:100526422-100526444 GCAGAAGCACTGCCAGGAGCTGG - Intronic
1132467540 16:84436-84458 TCCGAAGCTTAGCCTGGAGGTGG - Intronic
1132520297 16:384162-384184 GCTTGGGCCCAGCCTGGAGCAGG - Intronic
1132894779 16:2223656-2223678 GCAGAAGCCCAGGCCGAAGCCGG + Exonic
1133106137 16:3510913-3510935 GGGAAAGCCCAGGCTGGAGCTGG + Intronic
1133113507 16:3563461-3563483 GAGGAAGCCCAGCCTGGGCCAGG + Exonic
1133771194 16:8868193-8868215 CCCAAGGCCCTGCCTGGAGCGGG + Exonic
1134303226 16:13009789-13009811 GCAGATGCCCTGCCTGGAGGAGG + Intronic
1134746610 16:16593664-16593686 GCGCAAGCCCAGACTGGAGCTGG + Intergenic
1134998864 16:18760016-18760038 GCGCAAGCCCAGACTGGAGCTGG - Intergenic
1135471385 16:22734553-22734575 GCCGCAGCCCTGCCAGGAGTAGG + Intergenic
1136669184 16:31840088-31840110 GCCTAAGGCTAGCCTGGTGCTGG - Intergenic
1137444362 16:48522802-48522824 GGGGAAGCTCAGCCTAGAGCTGG - Intergenic
1138038071 16:53628409-53628431 GCCCATGCCCAGCCTGAAGAAGG - Intronic
1138340319 16:56284944-56284966 GCGGTGGCTCAGCCTGGAGCAGG + Intronic
1141698132 16:85630034-85630056 TCAGAAGGCCAGCCTGGGGCTGG + Intronic
1141957536 16:87383072-87383094 GCCGAGGCCGTGCCGGGAGCTGG - Intronic
1142239694 16:88939660-88939682 CCCAACGCCCAGACTGGAGCGGG + Intronic
1142749995 17:1981645-1981667 GCCACAGCTCAGGCTGGAGCAGG - Intronic
1143166589 17:4900070-4900092 CCCGAAGCCCACCCTGGGGCTGG + Exonic
1143311527 17:5995084-5995106 GCCGGAGCCCAGCGTGGGGGAGG + Intronic
1143405650 17:6675569-6675591 GCTGAGGCACAGCCAGGAGCAGG - Intergenic
1144473431 17:15563734-15563756 GCGGAGGCGGAGCCTGGAGCAGG + Intergenic
1144639923 17:16931553-16931575 AGGGGAGCCCAGCCTGGAGCCGG - Intronic
1144923091 17:18781076-18781098 GCGGAGGCGGAGCCTGGAGCAGG - Exonic
1144964909 17:19070725-19070747 GCCGCAGACCGGCCAGGAGCAGG + Intergenic
1144983058 17:19181453-19181475 GCCGCAGACCGGCCAGGAGCAGG - Intergenic
1144985166 17:19196786-19196808 GCCGCAGACCGGCCAGGAGCAGG + Intergenic
1145867497 17:28250434-28250456 GCCAAGCCCCAGCCTGGAGAAGG + Intergenic
1146255751 17:31390991-31391013 ACTGAACCCCAGCCTGGACCCGG - Intergenic
1146815706 17:35940334-35940356 GCTGATTCCCAGGCTGGAGCAGG + Intronic
1147674899 17:42198406-42198428 CACCATGCCCAGCCTGGAGCTGG - Intergenic
1148157202 17:45431219-45431241 CCCGAAGCCCGGGCGGGAGCGGG - Intronic
1149089702 17:52763211-52763233 GCCACACTCCAGCCTGGAGCTGG - Intergenic
1149661839 17:58338204-58338226 GTGGAGACCCAGCCTGGAGCTGG + Intergenic
1151314315 17:73312242-73312264 GCCGGAGCGCAGGCTGGGGCGGG - Intergenic
1151518669 17:74613506-74613528 TTCAAACCCCAGCCTGGAGCTGG + Intronic
1151696817 17:75722075-75722097 GAGCAAGCCCTGCCTGGAGCCGG - Intronic
1152574493 17:81134103-81134125 GCCCAACCCCAGGCTGGAGTGGG + Intronic
1152750492 17:82060320-82060342 GCCACAGCCCTCCCTGGAGCTGG - Intronic
1153457359 18:5295670-5295692 GCCGCCGCACATCCTGGAGCTGG + Intronic
1153772406 18:8426271-8426293 ACGGAGGCCCAGCCTGGAGGCGG + Intergenic
1154438097 18:14361623-14361645 GCCGGCGCCAAGCCTGCAGCAGG - Intergenic
1157293835 18:46427759-46427781 CACGAAGCCCAGCCTGGTGGGGG + Intronic
1157496811 18:48162110-48162132 CACGAAGCCCTGCCTGGAGGTGG - Intronic
1158433700 18:57417333-57417355 GCTTAAGGCCAGCCTGGAGTAGG + Intergenic
1160510677 18:79451836-79451858 GCCGAAGCCCAGGCCGCAGATGG - Intronic
1160605380 18:80045966-80045988 GGCCAAGCCCCGCCTGGAGCAGG + Exonic
1160727706 19:624938-624960 GTGGAAGCCCAGCGTGGGGCTGG - Intronic
1160737688 19:671609-671631 GACGAGGGCCAGCCTGGGGCTGG - Intergenic
1160963247 19:1734106-1734128 GCTGATGCCAGGCCTGGAGCTGG - Intergenic
1161457545 19:4377068-4377090 GCCCATTCCCAGCCTGGAGCTGG + Intronic
1163214116 19:15863435-15863457 CCCTAAGCCCAGCCCTGAGCTGG - Intergenic
1163509659 19:17727202-17727224 GGCCACGCCCAGCCTGGAGCTGG + Exonic
1163747588 19:19057466-19057488 CTCGAAGCCCATCCTGGACCTGG + Exonic
1164069168 19:21750668-21750690 GCCGGAGCCCTGCCCGGGGCGGG + Intronic
1164596077 19:29531187-29531209 TCTGAGGCCCAGCTTGGAGCAGG - Intronic
1165079775 19:33300688-33300710 GGGGAAGCCCAGCCTATAGCAGG + Exonic
1165438869 19:35812538-35812560 GCCGAGACCAGGCCTGGAGCTGG + Exonic
1165858754 19:38895464-38895486 GCCGTGGTCCAGCCTGAAGCAGG - Intronic
1165958326 19:39515596-39515618 CCCGAATCCCTGCCAGGAGCTGG - Exonic
1166752553 19:45171380-45171402 GCCAGAGCCCAGCCCAGAGCCGG + Intronic
1167256237 19:48431164-48431186 GGCTATGCCCAGGCTGGAGCAGG - Intronic
1168351784 19:55680147-55680169 GCCCAAGCCCCGCCTGGCACTGG - Intronic
1168640164 19:58025864-58025886 GGAGAAGCCCAGCCTGAGGCTGG + Intergenic
925276028 2:2649088-2649110 GGAGAAGCACAGCCTGCAGCAGG - Intergenic
926116573 2:10217453-10217475 GCTGAACCCCAGCCTGGAACTGG - Intergenic
926219397 2:10925064-10925086 CCCTAAGCCCAGCCTGGCCCAGG + Intergenic
926479688 2:13377155-13377177 GCCGAAGCCAAGACTGAAGAGGG + Intergenic
927213253 2:20651310-20651332 GAAGAAGCCCAGCCTGGCCCTGG + Intergenic
927519915 2:23692512-23692534 GCCAGAGCCCAGCCTAGAGATGG + Intronic
927904881 2:26848866-26848888 GCGGCTGCCCAGCCCGGAGCGGG + Intronic
927980182 2:27370162-27370184 ACCGGAGCCCAGCGTGGCGCTGG + Intronic
928029112 2:27763905-27763927 GCATAAGGCCAGCCTGGGGCTGG - Intergenic
928155850 2:28875760-28875782 TCTGAAGCCCAGACAGGAGCAGG - Intergenic
930769936 2:55120738-55120760 GCCCGAGCCCTGCCTGGAGATGG - Intergenic
932560379 2:72862680-72862702 GCCAAAGCGCAGCCGGGACCTGG - Intergenic
932599360 2:73113064-73113086 GCCGCAGACCAGCCCGGAGCGGG + Intronic
934754782 2:96817263-96817285 GCCGAAGTCCAGCACGGTGCTGG - Exonic
937612588 2:123879634-123879656 GCCACAGCCCAGAGTGGAGCAGG + Intergenic
937991167 2:127663350-127663372 GCGGGAGCCCAGCATGCAGCAGG + Intronic
938162620 2:128999704-128999726 GCCGACTCCAAGCCTGGTGCTGG + Intergenic
942045539 2:172097287-172097309 GCCTCAGCCCACCCCGGAGCTGG + Intergenic
944457560 2:199911315-199911337 GCCGCGGCCCGGCCGGGAGCCGG - Exonic
947353542 2:229270974-229270996 GCCGGGGGCCAGCCTGGAGGAGG - Intronic
948706035 2:239792974-239792996 AGTGGAGCCCAGCCTGGAGCGGG - Intronic
948811081 2:240478769-240478791 GCCACAAGCCAGCCTGGAGCGGG + Intergenic
948911938 2:241009278-241009300 GCAGCAGCCCAGGCTGGAGATGG + Intronic
1168804500 20:664396-664418 CCAGAAGCCGGGCCTGGAGCTGG - Exonic
1169304204 20:4474319-4474341 CCAGAATCCCAGTCTGGAGCTGG + Intergenic
1169424307 20:5484529-5484551 GCAGCAGCCCCGCCTGGAGGAGG - Intergenic
1169899140 20:10535143-10535165 GCAGAAGGCCAGGCTGGAGCAGG + Intronic
1171199679 20:23231202-23231224 GCCTAAGCACATGCTGGAGCAGG - Intergenic
1171246507 20:23614247-23614269 ACCGAAGGCCAGCCTGCAGAAGG - Intergenic
1171790049 20:29514905-29514927 GCAGAACCCCTGCCTGGGGCTGG - Intergenic
1171868929 20:30511105-30511127 TCTGATGCCCAGGCTGGAGCTGG - Intergenic
1172107432 20:32525053-32525075 CCCGCTGCCCAGCCTGGAGCTGG - Intronic
1172764408 20:37343660-37343682 GCCCATGCCCAGCACGGAGCAGG - Intergenic
1173906279 20:46632002-46632024 GCTGCAGCCCAGCAGGGAGCTGG - Intronic
1173988705 20:47283096-47283118 GCAGAACCCCAGCTTGGAGAAGG + Intronic
1175405417 20:58722881-58722903 GCAAAAGCCCAGGCTGGAGTGGG + Intergenic
1175864729 20:62169203-62169225 GCCAAAGCCAAGTATGGAGCTGG + Intronic
1176021096 20:62962822-62962844 GCCGCTGAGCAGCCTGGAGCAGG + Intronic
1176159573 20:63641498-63641520 GCCGAAGGCCAGCCCGGATGAGG - Intronic
1178718473 21:34988108-34988130 TCCTAAGCCCAGCCTTGAGGAGG - Intronic
1179185504 21:39082775-39082797 GCGGCAGCCCAGCCAGGTGCCGG - Intergenic
1180009958 21:45042960-45042982 GCCCAAGGGCAGCCTGGAGGAGG + Intergenic
1180061572 21:45388083-45388105 GCCCAGGCCCAGGCTGGAGATGG + Intergenic
1180183965 21:46130415-46130437 GCAGGAGCCCAGCCTGGATGAGG - Intronic
1180967762 22:19799440-19799462 GCCAAGCCCCAGCCTGGACCTGG + Intronic
1181078848 22:20400770-20400792 GCCGACGCCCAGCCTGGGGCTGG - Intronic
1181408443 22:22701647-22701669 GCTGTACCCCAGGCTGGAGCTGG - Intergenic
1181461581 22:23089052-23089074 GCCCAAGCTCAGCATGGGGCAGG + Intronic
1181724699 22:24803851-24803873 GACAAAGCCAAGCCTGGAGGGGG - Intergenic
1182102765 22:27669664-27669686 GGCAGAGCCCGGCCTGGAGCTGG + Intergenic
1182422631 22:30256040-30256062 GCCCCAGGCCAGCCTGCAGCCGG + Intergenic
1183410246 22:37650688-37650710 GCTGAAGCCAAGGCTGGGGCCGG - Exonic
1183485089 22:38084249-38084271 GCCGAGGCCCAGCCTGGCCTGGG - Intergenic
1184560336 22:45259515-45259537 GCCGAGCCCCAGCCTGAAGAAGG + Intergenic
1184755403 22:46512932-46512954 ACAGAGGCCCAGCCTGGAGGAGG - Intronic
1185023220 22:48392805-48392827 GCGGAAGATCCGCCTGGAGCAGG + Intergenic
1185235918 22:49712837-49712859 CCCAGAGCCCAGCCTGGAGCTGG - Intergenic
1185394119 22:50578176-50578198 GGCGAAGGGCAGCCTGGAGTTGG + Intronic
950099095 3:10346280-10346302 GCTATAGGCCAGCCTGGAGCTGG - Intronic
950119937 3:10475036-10475058 GCAGAAGCCCAGGCTGAAACTGG - Intronic
950473897 3:13203927-13203949 GCCGAGTCCCAGCCTGGGACGGG - Intergenic
950686152 3:14619922-14619944 GGCCAAGCCCAGCATGGAGTGGG - Intergenic
951678338 3:25267375-25267397 GCGGAAGGCCAGAGTGGAGCTGG - Intronic
952410783 3:33048134-33048156 GCCAGAGCCCAGCATGGAGGGGG + Intronic
953657013 3:44862088-44862110 GCCGAAGGCCAGCTTGGCGGAGG - Exonic
954373547 3:50182840-50182862 CCCCAAGCCCTGGCTGGAGCAGG - Intronic
955015346 3:55064382-55064404 GCCCAGGCCCAGCCAGGTGCCGG + Intronic
955341819 3:58130798-58130820 GCCTGAGCCCAGCCCGGGGCCGG - Exonic
959014367 3:101116284-101116306 GCCCATGCCCAGCCTGAAGAAGG + Intergenic
959575178 3:107926118-107926140 GCCCAGGCCCATCCTGGACCCGG + Intergenic
960949950 3:122992879-122992901 GCCAAAGCCCAGGCAGCAGCTGG + Intronic
961206710 3:125088218-125088240 GCCCAAGCCCAGCCAGGAATGGG + Intronic
963916353 3:150862122-150862144 GCTGAGGCAGAGCCTGGAGCAGG - Intergenic
967248251 3:187510622-187510644 TCTGTAGCCCAGGCTGGAGCTGG - Intergenic
968506474 4:973435-973457 GCCGCCGCCCAGCCAGGCGCGGG + Exonic
968917894 4:3505204-3505226 GCTGAAGAGCAGCCTCGAGCTGG - Intergenic
969316304 4:6383250-6383272 GGCCAAGCCCAGCCTCCAGCAGG + Intronic
969435778 4:7188581-7188603 CCCAGTGCCCAGCCTGGAGCTGG + Intergenic
969682126 4:8649249-8649271 CGCCAGGCCCAGCCTGGAGCAGG + Intergenic
970637211 4:18022079-18022101 CCCGGAGCCCAGCCAGGAACCGG + Intergenic
971266387 4:25099657-25099679 GCCAAATCCCAGCCTGGCGTTGG - Intergenic
972448945 4:39176892-39176914 TCTGAAGCCCAGGCTGGAGTGGG - Intergenic
975706111 4:77113316-77113338 GCCGAAGCCACGGCAGGAGCGGG - Intergenic
977693765 4:99946241-99946263 CCCGAGCCCCAGCCCGGAGCCGG + Intronic
981049396 4:140295581-140295603 GCCGGAGCCCAGCCAGCAGGCGG - Intronic
984905336 4:184621034-184621056 GCCCAAGCCCAGGCTGGACGTGG + Intergenic
985145309 4:186889645-186889667 GACGATGCCCACACTGGAGCTGG - Intergenic
985444676 4:190015423-190015445 GCCGCAGCCCCACCAGGAGCCGG + Intergenic
985724314 5:1507759-1507781 GCCAATGCCGAGCCTGGTGCAGG + Intronic
985800819 5:2004583-2004605 GCCGAAGCCCTGTGTGGGGCAGG + Intergenic
986169827 5:5306611-5306633 GCCGAAGCCCAGCCTGGAGCTGG + Exonic
986300594 5:6475768-6475790 GCCGAAGCTCTGCCAGGTGCTGG + Intronic
986402939 5:7396581-7396603 GCCGAGGGGCAGCCCGGAGCGGG - Intronic
986446493 5:7825772-7825794 GCCCAAGCCCAGGCAGGCGCGGG + Intronic
987321106 5:16770115-16770137 GCCTCAGCCAAGCCAGGAGCTGG - Intronic
991692128 5:69235230-69235252 GCTGAAGAGTAGCCTGGAGCTGG + Intronic
992104135 5:73436597-73436619 GCCGAAGCCCGCGCTGGGGCTGG + Intergenic
995841017 5:116443330-116443352 GCTCAAACCCAGCCTGGAGCAGG - Intergenic
998148275 5:139742857-139742879 GCCAAATTCCAGCCTGGAGTGGG + Intergenic
998406682 5:141878272-141878294 GCCGCAGCCCAGGCCGGGGCCGG - Exonic
999245208 5:150150563-150150585 GCCCACCCCCAGCCTGGTGCAGG - Intronic
999772560 5:154786546-154786568 TCCGAGGCCCAGACTGTAGCAGG - Intronic
1001314011 5:170630011-170630033 CCCCAGGCCCAGCCTGGTGCAGG - Intronic
1002204680 5:177554341-177554363 GCCGCCGCCAAGCCTGGAGGCGG - Exonic
1002519622 5:179784397-179784419 CCTGAAGCCCAGCTTGCAGCAGG + Intronic
1002524327 5:179806929-179806951 GCCGCGGCCCGGCCTGGATCTGG + Intronic
1002840118 6:898220-898242 GGCAAAGCCCAGCCTGGGGCTGG - Intergenic
1004342378 6:14818914-14818936 GGAGAAGCTCAGACTGGAGCTGG - Intergenic
1004638326 6:17489758-17489780 GCCAGATCCCAGTCTGGAGCTGG + Intronic
1005098735 6:22146693-22146715 GGCGAAGCCCAGGCGGGAGACGG - Intergenic
1007380936 6:41489695-41489717 GCGGGAGCCCTGCCTGGGGCTGG - Intergenic
1007614070 6:43170456-43170478 CCCCAAGTCCAGCCTGCAGCTGG + Intergenic
1008037225 6:46758658-46758680 GCCGATTCCCAGGCTGGAACAGG + Intronic
1008369430 6:50715565-50715587 GCCAGGGCCCAGCCTGGGGCTGG + Exonic
1013619368 6:111873127-111873149 GCCGAATCCCTCCCTGGCGCGGG + Exonic
1013667877 6:112366707-112366729 GGAGCAGCCCAGCCAGGAGCAGG - Intergenic
1014947342 6:127514831-127514853 GCTGTTGCGCAGCCTGGAGCAGG - Exonic
1017827867 6:158095798-158095820 GACGAAGCCCCTCCTGGGGCAGG + Exonic
1017891608 6:158644283-158644305 CCCCAGCCCCAGCCTGGAGCGGG - Intronic
1018736245 6:166689058-166689080 GCCGAAGGCCAGCCCTGAGCAGG + Intronic
1019006130 6:168798321-168798343 GCCAATGCCCAGCCTGACGCTGG - Intergenic
1019281618 7:203178-203200 GCCCAACCCCAGCCTGGGGAGGG - Intronic
1019322159 7:420711-420733 GGGGAAGGCCAGCCTGGAGCTGG - Intergenic
1020230928 7:6317962-6317984 GGCCAAGTCCAGCCTGGAGCTGG + Intergenic
1020713330 7:11636596-11636618 GCCCAAGCCTCTCCTGGAGCAGG - Exonic
1021969451 7:25951648-25951670 GCCGGAGCCCTGCCTGGGCCCGG + Intergenic
1022528256 7:31052142-31052164 CCCGCAGCACAGACTGGAGCAGG - Intergenic
1022734466 7:33062924-33062946 CCCGGAGCCCAGGCTGGAGGCGG + Intergenic
1024035281 7:45502970-45502992 GCAGGAGTCCACCCTGGAGCAGG + Intergenic
1025109025 7:56197203-56197225 GCTGACCCACAGCCTGGAGCAGG + Intergenic
1025787507 7:64657218-64657240 GCCTAGGCCCAGCCTGGAGACGG + Intergenic
1026802929 7:73411157-73411179 GCCCAAGCCCAGGCTGGCACTGG + Intergenic
1026824708 7:73574171-73574193 GGGGAAGCCAAACCTGGAGCCGG + Intronic
1026840460 7:73667852-73667874 GCCGGAGCGGATCCTGGAGCCGG + Exonic
1029640264 7:101815924-101815946 GCCAAAACCCGGCCTGGAGCCGG - Intronic
1032097920 7:128948744-128948766 GCCCAGGCCCCTCCTGGAGCAGG + Exonic
1033563937 7:142560554-142560576 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033564326 7:142563868-142563890 GCAGAAGCCCAGCCTGATGATGG - Intergenic
1033641048 7:143263563-143263585 CTCGAAGCCCAGCCAGGAGTAGG - Exonic
1033664906 7:143431252-143431274 GCATAAGTCCAGACTGGAGCAGG - Intergenic
1035640909 8:1184607-1184629 GCAGATGCCGAGCCTGGGGCTGG + Intergenic
1035782085 8:2235754-2235776 GCCTAAGCCCCGCATGCAGCAGG + Intergenic
1035810036 8:2483665-2483687 GCCTAAGCCCCGCATGCAGCAGG - Intergenic
1036741158 8:11362943-11362965 GCTGACTCCCAGCCTGGAGGAGG + Intergenic
1037803521 8:22047711-22047733 GCTGAGGCCCAGCCTGGTTCAGG + Intronic
1038002139 8:23401068-23401090 ACCGAAGCCCAGCCATGAGGAGG + Intronic
1039407663 8:37326853-37326875 GAGGAAGCCCAGCCTGGGTCAGG - Intergenic
1039454388 8:37697645-37697667 GCCCAAGCCCAGCCCGGAGCCGG + Exonic
1041051566 8:53939645-53939667 GCCCCAGGCCAGCCCGGAGCGGG + Exonic
1042858917 8:73294532-73294554 GCCGATGCCGAGGCTGGCGCGGG + Intronic
1046902285 8:119536312-119536334 GCCTAAGCCAAGCCTGTAGCTGG - Intergenic
1048317809 8:133375122-133375144 GCAGCGGGCCAGCCTGGAGCAGG - Intergenic
1048490262 8:134885534-134885556 GCCGAGGCCCAGGTAGGAGCAGG + Intergenic
1049212254 8:141392171-141392193 CCCGAAGCCGTGCCCGGAGCGGG - Intronic
1049245900 8:141562379-141562401 CTCCAAGCCCAGGCTGGAGCAGG + Intergenic
1049508852 8:143017981-143018003 GGAACAGCCCAGCCTGGAGCGGG + Intronic
1049536763 8:143186127-143186149 CCCGACGCCCAGGCCGGAGCCGG - Intergenic
1049572419 8:143375488-143375510 GGCGAGGCGCAGCCTGGTGCGGG + Intronic
1049624655 8:143614584-143614606 GCTGAGGCCCAGCCAGGAGTCGG - Intronic
1049635291 8:143684929-143684951 GCAGGAGCTCAGCCTGGGGCCGG - Intronic
1049673961 8:143881565-143881587 GCCGAGGAGAAGCCTGGAGCTGG + Intergenic
1052980005 9:34441165-34441187 GCCAGAGCCCAGGCTGGGGCAGG + Intronic
1053424853 9:38004048-38004070 TCCAAAGCCCAGGCAGGAGCAGG - Intronic
1057466413 9:95317880-95317902 GCGGAAGCCCCGGCGGGAGCAGG + Intergenic
1057804563 9:98211036-98211058 GCCCAGGCCCAGGTTGGAGCTGG + Intronic
1060553695 9:124497711-124497733 GCCAGAGCAGAGCCTGGAGCAGG - Intronic
1060642304 9:125249313-125249335 GCCGGATCCCAACCTGTAGCTGG + Intergenic
1060931060 9:127489834-127489856 GGGGAAGTCCTGCCTGGAGCAGG - Intronic
1061003453 9:127915600-127915622 GCCTAGACCCAGCCTGGGGCTGG + Intronic
1061257067 9:129459460-129459482 ACCGAGGCCCAGCCAAGAGCTGG + Intergenic
1061406112 9:130393893-130393915 GCAGGGGCCCAGCCTGCAGCTGG + Intronic
1061792255 9:133064897-133064919 GCCGTTGCCCAGCCTGGGGCAGG + Intronic
1061860991 9:133468728-133468750 GCTGAGGCACAGCCTGGAGAGGG + Exonic
1062076051 9:134590583-134590605 GAAGGAGCCAAGCCTGGAGCTGG + Intergenic
1062102968 9:134738013-134738035 ACAGAAGTTCAGCCTGGAGCTGG + Intronic
1062215008 9:135384420-135384442 GCCAAAGTCCAGCCTCCAGCAGG + Intergenic
1062322617 9:135997854-135997876 GCTGTGGCCCAGCATGGAGCTGG + Intergenic
1062376147 9:136262747-136262769 CCTGCAGCCCAGCCTGGAGCAGG + Intergenic
1062469795 9:136697264-136697286 GCCGAAGTCCAGCCAGGCTCAGG + Intergenic
1186404737 X:9291898-9291920 GCCGCAGCCCTGCCGGGGGCCGG - Intergenic
1190423609 X:50310758-50310780 GGAGAAGCCCAGCATTGAGCAGG + Exonic
1190881683 X:54496120-54496142 GCCGAGACCCAGGCTGAAGCTGG - Exonic
1192145621 X:68680360-68680382 ACACAAGCCCAGCCTGGAGCTGG - Intronic
1196016491 X:110945043-110945065 ACCGCAGCCTAGCCTGGAGCTGG - Intronic
1200137437 X:153882009-153882031 GAAGGAGCCCAGCCTGGGGCAGG + Intronic
1202378440 Y:24257893-24257915 CCATAAGCCCAGCCTGGTGCTGG + Intergenic
1202492342 Y:25412228-25412250 CCATAAGCCCAGCCTGGTGCTGG - Intergenic