ID: 986170102

View in Genome Browser
Species Human (GRCh38)
Location 5:5308061-5308083
Sequence CATGCAACCCTGGCCGGAGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 107}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986170102_986170109 2 Left 986170102 5:5308061-5308083 CCGCCTCCGGCCAGGGTTGCATG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 986170109 5:5308086-5308108 CATAACAGGTGGCACACCCAAGG 0: 1
1: 0
2: 1
3: 8
4: 137
986170102_986170107 -9 Left 986170102 5:5308061-5308083 CCGCCTCCGGCCAGGGTTGCATG 0: 1
1: 0
2: 1
3: 7
4: 107
Right 986170107 5:5308075-5308097 GGTTGCATGACCATAACAGGTGG 0: 1
1: 0
2: 0
3: 3
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986170102 Original CRISPR CATGCAACCCTGGCCGGAGG CGG (reversed) Intronic
901309108 1:8255291-8255313 CAGGGAACCCTGGCCGGGCGAGG - Intergenic
903826008 1:26146176-26146198 CATGCAACTCTGGCCTGAGAAGG - Intergenic
904613876 1:31739442-31739464 CAGGCAGCCCTGGCAGGGGGAGG - Exonic
910772224 1:90841923-90841945 TACGCAGCCCTGGCAGGAGGTGG + Intergenic
911303726 1:96207461-96207483 CATGCCAGCCTGGCCTAAGGAGG - Intergenic
913068657 1:115280379-115280401 CATGCACCCCTGGCTCCAGGGGG - Intergenic
914359821 1:146924353-146924375 CATGCAACTCTTGAAGGAGGTGG - Intergenic
914493930 1:148175541-148175563 CATGCAACTCTTGAAGGAGGTGG + Intergenic
915410007 1:155693669-155693691 GATGCAATCCTGGCCGGGAGTGG + Intronic
921149215 1:212386405-212386427 CATTCAACCCTGCCTGGAGAGGG - Intronic
921480897 1:215663577-215663599 CATGCAGCCCTGCCTGTAGGAGG + Intronic
923216324 1:231851501-231851523 CATTCACCCCTGTCCGAAGGGGG + Intronic
1062806397 10:422954-422976 GATGCTGCCCTGGCTGGAGGTGG + Exonic
1067441458 10:46311144-46311166 CAGGCAACCCTGGCCAAGGGTGG + Intronic
1067538625 10:47135681-47135703 TATGCAACCATGGTGGGAGGGGG - Intergenic
1072683061 10:97520674-97520696 CAGGCAGCCCTGGCCAGGGGTGG - Intronic
1074868211 10:117557206-117557228 CAGACCACCATGGCCGGAGGGGG - Intergenic
1076723442 10:132402702-132402724 CCTGCAACCCTGGGCGGGGGTGG + Intronic
1077462948 11:2719974-2719996 CTTGCACGCCTGGGCGGAGGTGG + Intronic
1084422103 11:69065598-69065620 CCTGCCACCCTGGCCTGGGGCGG + Intronic
1084649451 11:70480162-70480184 CATGAAACCATGGCCAGATGAGG - Intronic
1085907774 11:80785326-80785348 CATTCAACCCTGGGCATAGGAGG - Intergenic
1090296500 11:125592840-125592862 CACCCAACCCTGGCAGGAGCCGG - Exonic
1094411408 12:30171323-30171345 CATGCTACCCTGGAAAGAGGAGG - Intergenic
1097055010 12:56243922-56243944 CTTGCCACCCTGTCTGGAGGTGG - Intronic
1105702624 13:22944445-22944467 AATGCAGCGCTGGCTGGAGGGGG - Intergenic
1106224855 13:27777305-27777327 CATGCCACCCTTGCTGGAAGGGG - Intergenic
1107659439 13:42624045-42624067 CATGCAGCCCTTGCTGGAAGAGG - Intergenic
1110560680 13:76908090-76908112 CAAGAAACCCTGGCCGGGCGCGG + Intergenic
1114221257 14:20699445-20699467 CATGCCATCCTGGCCATAGGAGG - Exonic
1114222652 14:20710808-20710830 CATGCAACTCTTCCCAGAGGAGG - Intergenic
1114528293 14:23379670-23379692 CATGAAGCTCTGGCCAGAGGAGG + Exonic
1117978544 14:61321173-61321195 CAAGAGGCCCTGGCCGGAGGCGG - Intronic
1122581293 14:102773321-102773343 CAAGCATCCCTGGCCCGAGAAGG + Intergenic
1128612749 15:69087218-69087240 CCTGCACCCCTGGCCGGAGCTGG + Intergenic
1132221503 15:100108829-100108851 CAGGCAACACTGGCGGCAGGAGG + Intronic
1133014796 16:2934432-2934454 CCTGAAACGCTGGCCCGAGGAGG + Intronic
1133257090 16:4523709-4523731 CAAGCAAACCTGGGAGGAGGTGG + Intronic
1133639815 16:7705926-7705948 CATGCATCCCTGGCCAAAGTGGG - Intronic
1136298118 16:29315029-29315051 CAGGCATGCCTGGCCTGAGGTGG - Intergenic
1141868630 16:86768983-86769005 CACGCACCACTGGCTGGAGGGGG - Intergenic
1144109889 17:12021159-12021181 GATCCAAGCCGGGCCGGAGGCGG - Intronic
1147142056 17:38465615-38465637 CCTTCAAGCCTGGCAGGAGGTGG + Intronic
1148551652 17:48554191-48554213 CAAGCAGCCCTGGCTGAAGGGGG + Intronic
1150985932 17:70197141-70197163 CATGCAATGCTGGCCGGGTGTGG + Intergenic
1151856020 17:76722553-76722575 AATTAAACCCTGGCCGGGGGTGG + Intronic
1152115494 17:78384321-78384343 CCTGCAACCCTGGCAGCAGGCGG - Intronic
1152943115 17:83182820-83182842 CAGGCTACCCTGGCCCAAGGTGG - Intergenic
1157404029 18:47408769-47408791 CATTCAACCCTGGCCAGAGGAGG + Intergenic
1160433067 18:78825524-78825546 CCTGCAACCAGGGCAGGAGGTGG + Intergenic
1160832654 19:1110950-1110972 CATGCAACCTTGGCCTCGGGTGG - Intronic
1160993472 19:1871294-1871316 CCTGCAGGCCTGTCCGGAGGTGG - Intergenic
1162587433 19:11568996-11569018 AATGCAATCCTGGCCAGGGGTGG - Intronic
1163371947 19:16906022-16906044 CCAGGAAGCCTGGCCGGAGGCGG + Intronic
1166749861 19:45159553-45159575 CCTGCCACCCTGGCCCGAGCTGG - Intronic
925742224 2:7015888-7015910 CATGAAAACATGGCCGGATGGGG + Intronic
929030790 2:37648524-37648546 CCAGCAACCCAGGCCGGAGAAGG + Intronic
930343688 2:50150803-50150825 CATACACCCCTGGCCAGAGTTGG + Intronic
933686658 2:85147230-85147252 GCTGCAACCTTGGCCTGAGGTGG - Intronic
934755092 2:96819159-96819181 CATGCCACCCTGCCCTGGGGAGG + Intronic
936460874 2:112713074-112713096 CAGACAGGCCTGGCCGGAGGGGG - Intergenic
938735709 2:134184842-134184864 CATGCAAGGCTGGCCAGAGCGGG + Intronic
941095645 2:161237777-161237799 CACGCAACCCGGGGCTGAGGGGG - Intergenic
944738442 2:202589396-202589418 CATGCAAGCCGGGCCTGGGGTGG + Intergenic
1169272604 20:4212116-4212138 AAGGCACCCCTGGCCAGAGGTGG - Intergenic
1173863891 20:46302026-46302048 CAGGCAACCCTGGTCAGAGTTGG + Intronic
1176145421 20:63563292-63563314 GCTGCAGCGCTGGCCGGAGGCGG - Exonic
1179981853 21:44899957-44899979 GATGGGACCCTGGCCAGAGGCGG + Intronic
1183264646 22:36817664-36817686 TATGCATCCCTGGCCAGATGTGG - Intronic
1184785243 22:46668445-46668467 CGTTCAACCCTGGCCAGGGGCGG - Intronic
1185044840 22:48523652-48523674 CATGCAGCCCTGGCCCAAGTTGG - Intronic
952382862 3:32818059-32818081 TTTGCAACCCAGCCCGGAGGAGG - Exonic
954025662 3:47781548-47781570 CACGCGACCGGGGCCGGAGGCGG - Intronic
954449314 3:50563198-50563220 CATGCAACCCTGGACAGGAGGGG - Intronic
960697068 3:120406612-120406634 CATACAACTCTGGCCTGGGGAGG - Intronic
961033644 3:123627327-123627349 CCTGCCACCCTGTCTGGAGGAGG + Intronic
961440330 3:126948970-126948992 CATGCTACCCAGGCCAGAAGGGG + Intronic
963527364 3:146431085-146431107 CAAGCATCCTTGGCCTGAGGGGG - Intronic
968440407 4:621110-621132 GAAGCAGCCCTGGCCGGTGGGGG - Intergenic
969134433 4:5019258-5019280 CATGCACCCCTGTCCTGAGCGGG + Intronic
975829730 4:78356692-78356714 CATGAAACCCTTGCTGGAGGAGG - Intronic
978368720 4:108009025-108009047 CATGCCACCCTGGCTGAGGGAGG - Intronic
982712175 4:158768862-158768884 CACGTAACCCCGGCGGGAGGCGG - Intergenic
983794662 4:171846405-171846427 CCTACAACCATGGCCAGAGGAGG + Intronic
984499796 4:180545232-180545254 TAAGCAACCCTGGCCGGGCGCGG - Intergenic
984804947 4:183743356-183743378 CATGCAAGACTGGCCGGGCGCGG - Intergenic
986170102 5:5308061-5308083 CATGCAACCCTGGCCGGAGGCGG - Intronic
987094646 5:14537270-14537292 AATGCAATCCTGGCTGGACGCGG - Intergenic
990245851 5:53862855-53862877 CAAGCAACCCAGGCCGGGCGCGG + Intergenic
998118108 5:139554068-139554090 CATGGAACCTTGGCCGGGCGTGG - Intronic
1001622482 5:173099988-173100010 CATTCAAACCTGGGAGGAGGAGG - Intronic
1013667860 6:112366643-112366665 CGTGCACCCCTGGCTGGTGGAGG + Intergenic
1019013396 6:168861212-168861234 CCTGCAAACGTGGCCGGCGGAGG - Intergenic
1020010733 7:4804494-4804516 AATGCACCCCTGGCCGGGGGTGG + Intronic
1020883031 7:13786724-13786746 AATGCATCCCTGGCCGGGCGCGG + Intergenic
1023090699 7:36614918-36614940 CATGGAACACTGGCAGGAGGAGG + Intronic
1024255841 7:47539498-47539520 ATTGCAAGCCTGGCAGGAGGAGG - Intronic
1027260128 7:76458952-76458974 AATGGAACTCTGGCCGGATGCGG + Intergenic
1027311503 7:76957056-76957078 AATGGAACTCTGGCCGGATGCGG + Intergenic
1034587875 7:152111942-152111964 CAGGCACCCCTGTCCCGAGGAGG + Intronic
1036293561 8:7517198-7517220 CAGGGACCCCTGGCTGGAGGTGG - Intergenic
1036329000 8:7803797-7803819 CAGGGACCCCTGGCTGGAGGTGG + Intergenic
1037700983 8:21273583-21273605 CATGCAAGCCTGGATGGGGGTGG - Intergenic
1038197276 8:25379932-25379954 CATGCAAGTCTGGTTGGAGGGGG - Intronic
1041257954 8:55995593-55995615 CATGCACACCTGGCAGGAGAGGG + Intronic
1045658627 8:104412619-104412641 CCTGCAACCCTGGCAGGGGTGGG - Intronic
1046528514 8:115413553-115413575 CATGAAACCCTAGGCAGAGGAGG - Exonic
1048442443 8:134469881-134469903 CATCCCACCCTGACCGGAGCTGG + Intergenic
1052715607 9:32112668-32112690 ACTGCAACCCTGGCCTGAGAAGG + Intergenic
1053288436 9:36864671-36864693 CATGCTGGCCAGGCCGGAGGAGG - Intronic
1055085055 9:72305336-72305358 CATCCAACCCTGGCTCCAGGAGG + Intergenic
1057081037 9:92174902-92174924 CACTCAACCCTGGCCGGGTGTGG + Intergenic
1060219051 9:121754845-121754867 CATGCGCCCCAGGCAGGAGGCGG + Intronic
1061957122 9:133969588-133969610 CCTGCAACCTTGGCCAGTGGGGG + Intronic
1189608800 X:42708955-42708977 CAAGAAACACTGGCCGGACGTGG - Intergenic
1200836633 Y:7738734-7738756 CTTGCAACCTTGGACGGGGGTGG - Intergenic