ID: 986171215

View in Genome Browser
Species Human (GRCh38)
Location 5:5316323-5316345
Sequence TTGGAAGTCCTGGTGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 186}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986171215_986171219 6 Left 986171215 5:5316323-5316345 CCACCATGCACCAGGACTTCCAA 0: 1
1: 0
2: 2
3: 14
4: 186
Right 986171219 5:5316352-5316374 ATCTGACCCAATCTTCTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986171215 Original CRISPR TTGGAAGTCCTGGTGCATGG TGG (reversed) Intronic
900003848 1:31046-31068 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
900023570 1:201566-201588 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
900656587 1:3761815-3761837 TGTGAAATCCTGGGGCATGGAGG + Intronic
902547517 1:17199234-17199256 CTGGACCTCCTGGTGAATGGGGG - Intergenic
906701981 1:47866253-47866275 TTGGAAGTCATAGTCCAGGGAGG + Intronic
907200759 1:52725056-52725078 TTGGAAGTCATGGTGGGTGCTGG + Intergenic
907490659 1:54806918-54806940 TGGGCAGTTCTGGAGCATGGGGG - Intronic
909686136 1:78351094-78351116 TTAGCAGTCCTCATGCATGGTGG - Intronic
910123448 1:83815470-83815492 TGGGAAGCCCTGGTTCATGATGG - Intergenic
912006530 1:104908926-104908948 AGGGAAGTCCTGGTGGAAGGGGG - Intergenic
913609607 1:120497222-120497244 TGGGAAGTTCTGGTTAATGGAGG + Intergenic
913971452 1:143420972-143420994 TTGGAAGCCCAGGTCCAAGGAGG - Intergenic
914065829 1:144246585-144246607 TTGGAAGCCCAGGTCCAAGGAGG - Intergenic
914113322 1:144719769-144719791 TTGGAAGCCCAGGTCCAAGGAGG + Intergenic
914581583 1:149024622-149024644 TGGGAAGTTCTGGTTAATGGAGG - Exonic
915218224 1:154353889-154353911 TATGGAGTCCTGGGGCATGGTGG - Intergenic
916866805 1:168868573-168868595 TTTGAAGTCCTGGAACATGGTGG + Intergenic
919557819 1:199082918-199082940 TTGGAATTCCTGGTTGTTGGAGG - Intergenic
919836191 1:201575084-201575106 TTTGAAGTCCTGATGCAGAGTGG + Intergenic
920779356 1:208973524-208973546 TTGGAAGTCCAAGATCATGGTGG - Intergenic
921178881 1:212616097-212616119 GTGGAAGTATTGGTGCCTGGTGG + Intronic
922063375 1:222112707-222112729 TGGGAAGTCCAAGAGCATGGTGG - Intergenic
1063115910 10:3071646-3071668 CTGAAGGTCCTGGTGCCTGGTGG + Intronic
1065163256 10:22945937-22945959 TTGGAATGCCTGGGGTATGGTGG - Intronic
1065310930 10:24415432-24415454 GTGGAAGTACAGGTGCAAGGAGG - Intronic
1066095101 10:32064858-32064880 TTGGAAAACCTTGTGCATGTTGG + Intergenic
1067224489 10:44366780-44366802 TTGGAGGTGCAGGTGCAGGGTGG + Intergenic
1068948108 10:62749754-62749776 TTGGAAGCCATTGTGGATGGAGG - Intergenic
1069081997 10:64098501-64098523 TTGGAAGTCCAAGAGCATGGTGG - Intergenic
1069769988 10:70892342-70892364 TTGGGAGTCATGGTTCATTGGGG - Intergenic
1070683841 10:78467595-78467617 TTGGCAGACCTGGGGCTTGGTGG + Intergenic
1071497234 10:86177143-86177165 TTGGAAGTGCTTGTTCCTGGAGG - Intronic
1074029776 10:109675379-109675401 TTGCAAGTTCTGCTTCATGGGGG - Intergenic
1074056447 10:109926532-109926554 TTGGCAGTCCTGGTGTTTGTTGG - Intergenic
1074859711 10:117501184-117501206 TTGGCTGTCGGGGTGCATGGGGG - Intergenic
1075612066 10:123862286-123862308 GTGGAATGCCTGGGGCATGGCGG - Intronic
1075810664 10:125222500-125222522 ATTGCAGGCCTGGTGCATGGTGG + Intergenic
1076908697 10:133376962-133376984 CTGGAAGGCCTGGTGCAAGGAGG - Intergenic
1077055621 11:591266-591288 GTGGAGGGCCTGGCGCATGGAGG + Intronic
1077350476 11:2090924-2090946 TGGGAAGACCAGGTGCAAGGTGG - Intergenic
1078233196 11:9461019-9461041 TTTCCTGTCCTGGTGCATGGTGG + Exonic
1080426439 11:32158906-32158928 TTGGATGCCCTTGTACATGGCGG - Intergenic
1083153942 11:60811014-60811036 TGGGAAGGCCTGGTGGGTGGTGG - Intergenic
1084938547 11:72600366-72600388 TTGGAAGCCCCAGTGCTTGGGGG - Intronic
1086288710 11:85279609-85279631 TTGGAGGTCCTGGGTAATGGTGG - Intronic
1089369140 11:117941719-117941741 TTGGAAGTGCTGGGAGATGGTGG - Intergenic
1091377267 12:33100-33122 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
1092384256 12:8023671-8023693 TTGGAAGTACTGGAGAAAGGGGG - Intergenic
1093929128 12:24937404-24937426 TGGGAACTTCTGGAGCATGGTGG + Intronic
1097470351 12:59983091-59983113 TTGAAGGTCCTGGTCAATGGGGG + Intergenic
1097882722 12:64700573-64700595 TTAGAGGTTCTGTTGCATGGGGG + Intergenic
1102316515 12:111892308-111892330 TTAGAATTGCTGGTTCATGGAGG + Intronic
1102624520 12:114224411-114224433 TTGGAAATCGGGGAGCATGGAGG + Intergenic
1102799849 12:115722579-115722601 TTGGAAGTCCTGGTGCCCAAGGG - Intergenic
1103157619 12:118699930-118699952 GTGGAAGCCCAGTTGCATGGAGG - Intergenic
1105410769 13:20169429-20169451 TTGGAGGACCTGGTGGATGCTGG + Intergenic
1107354809 13:39555869-39555891 TGGGAAGTACTGGATCATGGGGG + Intronic
1110915542 13:81016232-81016254 GCAGAAATCCTGGTGCATGGAGG - Intergenic
1112543814 13:100344282-100344304 TTGGAAGACCTGGTGGATGGTGG + Intronic
1118231623 14:63956979-63957001 TAGCAAGTACTGGGGCATGGGGG - Intronic
1122341723 14:101032985-101033007 CTGGAAGGCCTGATGGATGGTGG + Intergenic
1124435635 15:29646742-29646764 ATGGAAATCTTGGGGCATGGAGG + Intergenic
1126123118 15:45271151-45271173 TTGGAGATACTGCTGCATGGGGG + Intronic
1126621161 15:50641285-50641307 TCAGAAGTTCTGGTGTATGGTGG - Intronic
1127396821 15:58549861-58549883 TTGGAAGTCCTCCTGCTTCGGGG + Intronic
1128229878 15:66027045-66027067 CTGGGAGTGCTGGTGCATGAGGG - Intronic
1128245193 15:66128054-66128076 TGGGAAGTGCTAGTGCAGGGAGG + Intronic
1129450815 15:75650196-75650218 CTGCAAGTCCTGGTGCTCGGTGG - Exonic
1132117452 15:99147851-99147873 TTGGAATTCCTGGTATATGCAGG + Intronic
1132449655 15:101959890-101959912 TTGGAAGTCCAAGTTCAAGGTGG + Intergenic
1132582742 16:693079-693101 TTGGAAGTCCTGGGGGATGCTGG - Exonic
1135113634 16:19708874-19708896 TTGGAAGTGCTGGTTCACGCAGG - Intronic
1136106922 16:28036580-28036602 CAGGAAGTCCTGGTGAAGGGGGG - Intronic
1138241612 16:55431885-55431907 GGGGAAGTCTTGGGGCATGGTGG + Intronic
1139099175 16:63744564-63744586 GTGGCAGTGCTGGTGCAGGGCGG - Intergenic
1139406802 16:66725507-66725529 GTAGAAGTCATGGTCCATGGAGG - Intronic
1139406853 16:66725853-66725875 CTGGAAGTCCTGGTGCTGGTGGG - Exonic
1139442755 16:66977118-66977140 ATGGAAGCCCTGTTGTATGGAGG + Intergenic
1140132599 16:72176862-72176884 TTGGAACCCCTGTTTCATGGTGG + Intronic
1141265636 16:82494394-82494416 CTTGAAGTCCTAGAGCATGGAGG + Intergenic
1141614303 16:85202040-85202062 GTGCAAGTCCTGGTGGGTGGTGG + Intergenic
1141755380 16:85987563-85987585 TTGGAGGCGCTGGGGCATGGGGG - Intergenic
1142135455 16:88449953-88449975 TTGGAAGTGCTGGAGCTGGGAGG - Intergenic
1143926659 17:10377166-10377188 TTGTGAGTCCTGGTGGCTGGTGG + Intergenic
1146021418 17:29282216-29282238 TGGGAAGTCCAAGTGCATGGCGG - Intronic
1146669783 17:34729025-34729047 AGGGGAGTGCTGGTGCATGGTGG - Intergenic
1147684953 17:42281635-42281657 ATGGATGTGCAGGTGCATGGAGG + Intergenic
1149435846 17:56632503-56632525 TTGGGCGTACTGGTGCATGTCGG + Intergenic
1152798881 17:82321978-82322000 TTGGAAGACCTGGGGGGTGGAGG + Exonic
1155386717 18:25285842-25285864 GTGGCAGTCCTGATACATGGAGG - Intronic
1157193133 18:45597885-45597907 TAGGAATTGCTGGTGCATTGAGG + Intronic
1159899638 18:74033937-74033959 TTGAAAGTTCTTGTACATGGGGG + Intergenic
1160635601 19:72655-72677 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
1161426735 19:4207824-4207846 GTGGAGGTCCTGCTGCAGGGCGG + Exonic
1161452617 19:4354935-4354957 GTGGAAGTCCTGGGGAAGGGAGG - Exonic
1161746043 19:6060869-6060891 CTGGGAGTCCTGGTGCCGGGAGG - Intronic
1163628334 19:18403639-18403661 TTGGGAGTCCTGGGGCCTGAGGG + Intergenic
1165273763 19:34731943-34731965 TTGTATGTCCTGGAGAATGGAGG - Intergenic
1167354334 19:48993922-48993944 TTGTAAGTGTGGGTGCATGGAGG + Exonic
1167769740 19:51507687-51507709 TTGGTACTCCCGGTGCACGGAGG + Intergenic
925589940 2:5499451-5499473 TTTGAAGTCCTGCTGCATTGTGG - Intergenic
925614752 2:5734709-5734731 TGGGAAGTGCAGGTGCATGAGGG + Intergenic
927054691 2:19357670-19357692 TTGATTGTCCTGGTGCAGGGAGG - Intronic
928239766 2:29576388-29576410 TTGGAAGGCAGTGTGCATGGTGG - Intronic
928565663 2:32545815-32545837 TTGGAACTCGTGGGGAATGGTGG - Exonic
930772005 2:55138280-55138302 TCAGAAATCCTGGTGCATGCAGG - Intergenic
931218825 2:60270811-60270833 TTGGAACACCTGGGGCATGGGGG - Intergenic
932998121 2:76882784-76882806 TTGTGAGACCTGGTGGATGGTGG - Intronic
933804374 2:85987509-85987531 TTGGAGGTCCTGGTGGCTGTGGG + Intergenic
934034782 2:88079866-88079888 TTAGAATTGCTGGTACATGGTGG - Intronic
934176144 2:89581905-89581927 TTGGAAGCCCAGGTCCAAGGAGG - Intergenic
934286454 2:91656267-91656289 TTGGAAGCCCAGGTCCAAGGAGG - Intergenic
935355634 2:102196955-102196977 TTGGAAGGCCTTGAGAATGGTGG + Intronic
935450069 2:103199353-103199375 TTGAAAGTCCTGTATCATGGGGG + Intergenic
936565881 2:113582393-113582415 TTGGAAGTCCAAGTTCAAGGTGG + Intergenic
937333089 2:121044289-121044311 CTGGAACTCCTGGGGCCTGGGGG - Intergenic
938618140 2:133020932-133020954 TTGTCCGTCCTGGTGCCTGGAGG - Intronic
940005031 2:149002463-149002485 TTGTAAGTACTTGTGTATGGAGG - Intronic
941748900 2:169115117-169115139 TTAGAAAACCTGGTTCATGGAGG - Intergenic
942921006 2:181373565-181373587 TTGCCAGGCCTGGTGCTTGGAGG - Intergenic
944906217 2:204264587-204264609 TTTTATGGCCTGGTGCATGGTGG + Intergenic
944923543 2:204439490-204439512 CTGGAAGTCATGGTTCATTGGGG + Intergenic
947363218 2:229367090-229367112 ATGGAAGTCCGGGCACATGGCGG - Exonic
947370562 2:229441169-229441191 GGGGAAGTCCTGGGTCATGGGGG - Intronic
1169217018 20:3799961-3799983 GTGGAAGGCCTGGTGCAGGCTGG + Intronic
1172931513 20:38589438-38589460 TTAGAAGTCGTGGTGGCTGGTGG - Intergenic
1174553316 20:51376719-51376741 CTGGGAGTCCAGGGGCATGGGGG - Intergenic
1175486079 20:59347343-59347365 TTTGCAGACTTGGTGCATGGTGG - Intergenic
1176662995 21:9657374-9657396 TTGGAAGTCATAGTGTATGTTGG + Intergenic
1180077436 21:45469796-45469818 TTCTAAGTCCTGGTGTCTGGGGG + Intronic
1181479365 22:23188424-23188446 TTGGAAGTCCTGTGGCTGGGAGG + Intronic
1181985878 22:26799524-26799546 GCAGAAGGCCTGGTGCATGGTGG + Intergenic
1182828630 22:33286415-33286437 TTGGAATCCCTGGGGCAGGGGGG + Intronic
1183252069 22:36737287-36737309 GTGGAAGTGCTTGTGCAGGGTGG - Intergenic
1183355863 22:37359043-37359065 TTGGAAGCCCTGGGGCTTGGGGG + Intergenic
1183720447 22:39558783-39558805 GGGGAAGTCATGGTGCCTGGGGG + Intergenic
1184881706 22:47309142-47309164 TAAGAAGTCTTGGTGCCTGGTGG + Intergenic
1185057332 22:48587826-48587848 TCGGAAGGCCTGGAGCTTGGAGG + Intronic
950132894 3:10559647-10559669 TTGGAAGTCGGGGGGCTTGGAGG - Intronic
953976244 3:47383751-47383773 CTGGAGGCCCAGGTGCATGGAGG - Intronic
954463591 3:50641540-50641562 TTGTAGAACCTGGTGCATGGTGG - Intronic
955817234 3:62858154-62858176 TTGGAAGTCCAGATGAAAGGTGG + Intronic
956557057 3:70535921-70535943 TTGGAAGTCATAGGGGATGGAGG - Intergenic
962074474 3:132066793-132066815 TTGGAACTCCTTGGGTATGGGGG + Intronic
962535151 3:136321986-136322008 TTGGAAGTCCTGGCTAATGCAGG - Intronic
963057231 3:141195268-141195290 TTGGAAGTTCTGTTCCAAGGTGG - Intergenic
968492832 4:899654-899676 TTTGCTGTCCTGGGGCATGGCGG - Intronic
969515895 4:7648136-7648158 TTGCAGGACCTGGTGGATGGTGG + Intronic
970939353 4:21613342-21613364 TTGAATGTCCTCATGCATGGTGG - Intronic
981719576 4:147787807-147787829 TTGGAAGTCATGATGCCTGGGGG + Intronic
983542296 4:168924941-168924963 GTGGTTGTCCTGGTGCATGCTGG - Exonic
985412325 4:189698679-189698701 TTGGAAGTCATAGTGTATGTTGG - Intergenic
986171215 5:5316323-5316345 TTGGAAGTCCTGGTGCATGGTGG - Intronic
989949093 5:50275703-50275725 TGGGAAGCCCTGGTGGAAGGTGG - Intergenic
990010652 5:50993760-50993782 TGGGAAGTATTGGTTCATGGGGG + Intergenic
991631508 5:68660856-68660878 TTGGAAGGCCTGAGGCATGAAGG - Intergenic
992129076 5:73673485-73673507 TTGGAATTCCTGATCCCTGGAGG + Intronic
993823480 5:92650809-92650831 TTGGGAATCCAGGTGGATGGAGG - Intergenic
1002521207 5:179794120-179794142 CTGGGAGTCCTGCTGCAAGGTGG + Exonic
1002914360 6:1517195-1517217 TTGGAAGTGCTGGTGCTTCACGG - Intergenic
1003779902 6:9412967-9412989 CTGGAATTCATGGTTCATGGTGG + Intergenic
1007778481 6:44237510-44237532 TTGGCAGTCCTGGTGCTCGCTGG + Intergenic
1007914374 6:45547150-45547172 TTCGAGGTGGTGGTGCATGGCGG - Exonic
1011906459 6:92375643-92375665 TTGTAAGTCCTGGTGTTTGTGGG + Intergenic
1013777363 6:113693341-113693363 TTGGGAGTCATGGGGCAAGGAGG - Intergenic
1018831642 6:167448228-167448250 GTGCAAGTCTCGGTGCATGGTGG + Intergenic
1018860402 6:167707077-167707099 TGGGAAGGCCGGGTGCAGGGAGG - Intergenic
1019564407 7:1672265-1672287 GTGGCAGTCCTGGGGCATGGTGG - Intergenic
1019807972 7:3142662-3142684 TTGGAATTTCTGGGTCATGGGGG - Intronic
1022795204 7:33726682-33726704 TGGGAAGGCCTGCTGCATGATGG - Intronic
1023350849 7:39318997-39319019 TTGGATGTGGTGGTGCATGCAGG + Intronic
1024362505 7:48483020-48483042 TTAGAAGTCCTGGTGCTCTGTGG + Intronic
1027219891 7:76207012-76207034 TGGGAAGTCCTGGGAAATGGTGG - Intronic
1028776702 7:94685334-94685356 TTAGAATTGCTGGTGCATAGTGG + Intergenic
1031123324 7:117745484-117745506 TTAGAACTGCTGGAGCATGGTGG - Intronic
1032524640 7:132570800-132570822 TTGCGAATCCTGGTTCATGGAGG + Intronic
1035350691 7:158244143-158244165 ATGGAAGTCCTGGGGGAAGGAGG - Intronic
1035822539 8:2610093-2610115 ATGGAAATCCTGGGGCAAGGAGG - Intergenic
1036678901 8:10856275-10856297 ATTGAAATCATGGTGCATGGAGG + Intergenic
1039594077 8:38775451-38775473 CTGGAAGTTCTGGAGGATGGAGG + Intronic
1039993127 8:42506890-42506912 TGGAAAGTGCTGGTGCATGGGGG + Intronic
1041111593 8:54488003-54488025 CTGGAAGTCATGGTGCATGGGGG + Intergenic
1042522216 8:69725608-69725630 TTGTAAGTCGTGGGGGATGGTGG + Intronic
1043213156 8:77550904-77550926 GTGGAAATCCTGGTGCAGGAAGG - Intergenic
1048353744 8:133636611-133636633 TTGGGAGTACAGGTGCAGGGAGG + Intergenic
1048672170 8:136735282-136735304 TTGGGAGGCTTAGTGCATGGGGG + Intergenic
1049057351 8:140248661-140248683 TTAGAAGTCCTGGAAGATGGTGG - Intronic
1049659469 8:143813300-143813322 CTGGAAGTGCTGGTGCGTGGAGG - Exonic
1049886543 9:30828-30850 TTGGAAGTCCAAGTTCAAGGTGG - Intergenic
1050123472 9:2332226-2332248 TTGGAAGTGCTGGTGGCAGGGGG + Intergenic
1052262545 9:26534274-26534296 TTGGAAGTCCAAGTGCAAGGTGG - Intergenic
1061047470 9:128174362-128174384 TTGGAAGTCACTGTGCAGGGAGG + Intronic
1203670268 Un_KI270755v1:4302-4324 TTGGAAGTCATAGTGTATGTTGG + Intergenic
1187008722 X:15257868-15257890 TTGGAAGTATTCTTGCATGGTGG + Intronic
1187806865 X:23130235-23130257 ATTGAAGACGTGGTGCATGGGGG - Intergenic
1189703446 X:43735644-43735666 TTGGAAGTTCTGGAGCTGGGTGG + Intronic
1193923225 X:87455010-87455032 GAACAAGTCCTGGTGCATGGTGG - Intergenic
1198366270 X:135943027-135943049 TTGGGAGTACTTGTCCATGGAGG - Intergenic
1198549539 X:137730236-137730258 GTGGAGGTAGTGGTGCATGGTGG + Intergenic
1198932674 X:141878515-141878537 TGGGAGGCCCTGGGGCATGGTGG + Intronic
1199497612 X:148470719-148470741 TTGGAAATCCTGGTGAAAGGCGG - Intergenic
1201464958 Y:14270261-14270283 TGGGAAGTCCTGAGACATGGTGG - Intergenic
1202590681 Y:26480068-26480090 CTGGAAGTGCTGGTGTTTGGTGG + Intergenic