ID: 986172328

View in Genome Browser
Species Human (GRCh38)
Location 5:5324951-5324973
Sequence TTGGCTATAGAAGCAGACGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986172328_986172336 18 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172336 5:5324992-5325014 GGGTGGGCTGCATTTGCCTTAGG No data
986172328_986172334 2 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172334 5:5324976-5324998 TCACAACATCCAACTGGGGTGGG No data
986172328_986172333 1 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172333 5:5324975-5324997 ATCACAACATCCAACTGGGGTGG No data
986172328_986172331 -3 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172331 5:5324971-5324993 CAACATCACAACATCCAACTGGG No data
986172328_986172332 -2 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172332 5:5324972-5324994 AACATCACAACATCCAACTGGGG No data
986172328_986172330 -4 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172330 5:5324970-5324992 CCAACATCACAACATCCAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986172328 Original CRISPR TTGGCTATAGAAGCAGACGA AGG (reversed) Intergenic
No off target data available for this crispr