ID: 986172332

View in Genome Browser
Species Human (GRCh38)
Location 5:5324972-5324994
Sequence AACATCACAACATCCAACTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986172327_986172332 4 Left 986172327 5:5324945-5324967 CCAAAGCCTTCGTCTGCTTCTAT No data
Right 986172332 5:5324972-5324994 AACATCACAACATCCAACTGGGG No data
986172328_986172332 -2 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172332 5:5324972-5324994 AACATCACAACATCCAACTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986172332 Original CRISPR AACATCACAACATCCAACTG GGG Intergenic
No off target data available for this crispr