ID: 986172334

View in Genome Browser
Species Human (GRCh38)
Location 5:5324976-5324998
Sequence TCACAACATCCAACTGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986172328_986172334 2 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172334 5:5324976-5324998 TCACAACATCCAACTGGGGTGGG No data
986172327_986172334 8 Left 986172327 5:5324945-5324967 CCAAAGCCTTCGTCTGCTTCTAT No data
Right 986172334 5:5324976-5324998 TCACAACATCCAACTGGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986172334 Original CRISPR TCACAACATCCAACTGGGGT GGG Intergenic
No off target data available for this crispr