ID: 986172336

View in Genome Browser
Species Human (GRCh38)
Location 5:5324992-5325014
Sequence GGGTGGGCTGCATTTGCCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986172328_986172336 18 Left 986172328 5:5324951-5324973 CCTTCGTCTGCTTCTATAGCCAA No data
Right 986172336 5:5324992-5325014 GGGTGGGCTGCATTTGCCTTAGG No data
986172329_986172336 -1 Left 986172329 5:5324970-5324992 CCAACATCACAACATCCAACTGG No data
Right 986172336 5:5324992-5325014 GGGTGGGCTGCATTTGCCTTAGG No data
986172327_986172336 24 Left 986172327 5:5324945-5324967 CCAAAGCCTTCGTCTGCTTCTAT No data
Right 986172336 5:5324992-5325014 GGGTGGGCTGCATTTGCCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986172336 Original CRISPR GGGTGGGCTGCATTTGCCTT AGG Intergenic
No off target data available for this crispr