ID: 986177618

View in Genome Browser
Species Human (GRCh38)
Location 5:5365318-5365340
Sequence CTCCCCTACCATTCCTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986177618_986177629 16 Left 986177618 5:5365318-5365340 CCAGTGGAGGAATGGTAGGGGAG No data
Right 986177629 5:5365357-5365379 CGAAATAGGGTTCCAGGAGAGGG No data
986177618_986177628 15 Left 986177618 5:5365318-5365340 CCAGTGGAGGAATGGTAGGGGAG No data
Right 986177628 5:5365356-5365378 CCGAAATAGGGTTCCAGGAGAGG No data
986177618_986177626 10 Left 986177618 5:5365318-5365340 CCAGTGGAGGAATGGTAGGGGAG No data
Right 986177626 5:5365351-5365373 GACTGCCGAAATAGGGTTCCAGG No data
986177618_986177622 3 Left 986177618 5:5365318-5365340 CCAGTGGAGGAATGGTAGGGGAG No data
Right 986177622 5:5365344-5365366 TACCCCAGACTGCCGAAATAGGG No data
986177618_986177621 2 Left 986177618 5:5365318-5365340 CCAGTGGAGGAATGGTAGGGGAG No data
Right 986177621 5:5365343-5365365 TTACCCCAGACTGCCGAAATAGG No data
986177618_986177630 17 Left 986177618 5:5365318-5365340 CCAGTGGAGGAATGGTAGGGGAG No data
Right 986177630 5:5365358-5365380 GAAATAGGGTTCCAGGAGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986177618 Original CRISPR CTCCCCTACCATTCCTCCAC TGG (reversed) Intergenic
No off target data available for this crispr