ID: 986177621

View in Genome Browser
Species Human (GRCh38)
Location 5:5365343-5365365
Sequence TTACCCCAGACTGCCGAAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986177618_986177621 2 Left 986177618 5:5365318-5365340 CCAGTGGAGGAATGGTAGGGGAG No data
Right 986177621 5:5365343-5365365 TTACCCCAGACTGCCGAAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986177621 Original CRISPR TTACCCCAGACTGCCGAAAT AGG Intergenic
No off target data available for this crispr