ID: 986178961

View in Genome Browser
Species Human (GRCh38)
Location 5:5375952-5375974
Sequence GACACAGAACTGGTAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 242}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986178953_986178961 16 Left 986178953 5:5375913-5375935 CCTGGCCCACAGGAGGTAGGGCA 0: 1
1: 0
2: 4
3: 23
4: 239
Right 986178961 5:5375952-5375974 GACACAGAACTGGTAGTGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 242
986178954_986178961 11 Left 986178954 5:5375918-5375940 CCCACAGGAGGTAGGGCAGTGTG No data
Right 986178961 5:5375952-5375974 GACACAGAACTGGTAGTGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 242
986178955_986178961 10 Left 986178955 5:5375919-5375941 CCACAGGAGGTAGGGCAGTGTGT No data
Right 986178961 5:5375952-5375974 GACACAGAACTGGTAGTGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 242
986178948_986178961 28 Left 986178948 5:5375901-5375923 CCAGTGTGCAGTCCTGGCCCACA 0: 1
1: 0
2: 5
3: 24
4: 249
Right 986178961 5:5375952-5375974 GACACAGAACTGGTAGTGGAGGG 0: 1
1: 0
2: 2
3: 20
4: 242

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986178961 Original CRISPR GACACAGAACTGGTAGTGGA GGG Intergenic
901278250 1:8010034-8010056 GACCAAGAAAAGGTAGTGGAGGG + Intronic
903396241 1:23003769-23003791 GAAAAAGAACTGGAATTGGAAGG + Intergenic
903475392 1:23615882-23615904 GATACAGACCTGATGGTGGATGG - Intronic
904101866 1:28036929-28036951 GGCACAGAACTGGGAGAGAAAGG + Intronic
906378515 1:45316550-45316572 GAAAAAGAACTGGAATTGGAAGG - Intergenic
906526778 1:46498097-46498119 GACTCAGAACTGGATGTGGAAGG + Intergenic
906786327 1:48619139-48619161 GTCACACAACTGGTAGTCAAAGG - Intronic
909543109 1:76812931-76812953 GACCTAGAATTGGAAGTGGATGG - Intergenic
909752811 1:79184741-79184763 GAAATAAAACTGGTAGTAGAAGG + Intergenic
910441839 1:87261013-87261035 ATCACAGAACTGCTAGTTGATGG + Intergenic
910622429 1:89271501-89271523 TGCTCAGAAGTGGTAGTGGAAGG + Intronic
912145322 1:106786663-106786685 GAAACAGAACTGGTAGAGAGAGG - Intergenic
912308853 1:108598692-108598714 GACACACAAATGGGAGAGGAGGG - Intronic
912954381 1:114144231-114144253 GACAGGGAACAGGAAGTGGAGGG - Intronic
913244925 1:116863034-116863056 GAAAGAGAACTGGAATTGGAAGG - Intergenic
916758482 1:167795890-167795912 GAAAAACAACTGGGAGTGGAAGG + Intergenic
916795406 1:168162482-168162504 GAAAGAGAACTGGCAGGGGACGG + Intergenic
918151238 1:181799513-181799535 GAAACAGAACTGGTGGTGCTGGG + Intronic
919330974 1:196171196-196171218 TACCCAGAATTGGTAGTGGAAGG + Intergenic
920368507 1:205461762-205461784 GACACAGAAGTGAGGGTGGATGG - Intergenic
922598763 1:226834140-226834162 GAAAAAGAACTGGAATTGGAAGG - Intergenic
923320792 1:232830971-232830993 GACACAGAATGGGAATTGGAAGG + Intergenic
923536402 1:234855476-234855498 GACACAGAAATGGCTGTGGGGGG - Intergenic
1066184303 10:32994261-32994283 AATAAAGAACTGGTAGGGGAGGG - Intronic
1067214182 10:44287111-44287133 GACAGAGAACCAGAAGTGGAAGG - Intergenic
1067431898 10:46250765-46250787 GACACACATCTGGGAGTGGCCGG - Intergenic
1069514707 10:69068416-69068438 GACACAGAAGTGGTTGGTGAGGG - Intergenic
1070390642 10:75967739-75967761 GACACAGAGCTGGGAGAGGAGGG + Intronic
1075324175 10:121517499-121517521 GACACAGGAATGATTGTGGAGGG + Intronic
1075650818 10:124127647-124127669 GGGTCAGAACTGGGAGTGGAGGG - Intergenic
1076491432 10:130864183-130864205 GAGGCAGAACTGGTGGTGAATGG + Intergenic
1076792583 10:132785162-132785184 GAACCAGACCTGGGAGTGGACGG + Exonic
1078937083 11:15961451-15961473 AACACAGAACTCACAGTGGAGGG + Intergenic
1082632657 11:55560000-55560022 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1084914600 11:72419060-72419082 GACACAGAACAGGAAGTACAAGG + Intronic
1086030548 11:82349966-82349988 GACACAGAAAGAGCAGTGGAAGG - Intergenic
1086584370 11:88434133-88434155 GAAACATAAATGATAGTGGATGG - Intergenic
1091103748 11:132899168-132899190 AATACAGAATGGGTAGTGGAAGG + Intronic
1091321892 11:134657589-134657611 CACTCAGAACTGGTATTTGAGGG + Intergenic
1092060315 12:5545570-5545592 GAGACAGAAATGCTAGTGGGAGG - Intronic
1093302027 12:17470515-17470537 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1098322329 12:69258711-69258733 GAAAAAGAACTGGTGGTGGAGGG - Exonic
1098919695 12:76292351-76292373 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1099115463 12:78618924-78618946 GACAAATAACTAGGAGTGGAAGG + Intergenic
1099994938 12:89768439-89768461 AATACAGAATGGGTAGTGGATGG - Intergenic
1100586675 12:95986971-95986993 GACACAGAAGTGGTGGGGGCAGG - Intronic
1101053553 12:100888677-100888699 GACACAGAACAGGTGGAGAATGG + Intronic
1101967403 12:109291011-109291033 GACACAGAACAGGAGGTGGTGGG + Intronic
1102117005 12:110410454-110410476 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1102594526 12:113982177-113982199 GGCACAGAACTGGTGGTTGAGGG + Intergenic
1102604211 12:114056375-114056397 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1102915430 12:116748849-116748871 GTCACAGAGCTGGTAAGGGATGG - Intronic
1106993217 13:35449115-35449137 AACACAGAACTGGTAATGAGAGG + Intronic
1108282253 13:48871804-48871826 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1109713539 13:66189814-66189836 GATGCAGAATTGGTACTGGATGG - Intergenic
1113784122 13:112993539-112993561 GCCACAGAAGTGGCAGTGGGAGG + Intronic
1114221472 14:20701456-20701478 GAAAGAGAACTGGAATTGGAAGG - Intergenic
1114771237 14:25430317-25430339 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1115329069 14:32174521-32174543 GACCCAGAACTGTAAGTGGCTGG - Intergenic
1116046178 14:39745899-39745921 GAGACAGAACTGAGAGTGTAGGG - Intergenic
1118992973 14:70812319-70812341 GAACCAGAACTGGTCCTGGAGGG + Intergenic
1119157288 14:72422795-72422817 GAAAGAGAACTGGGAGAGGAAGG + Intronic
1119560546 14:75585824-75585846 GAAAAAGAACTGGAATTGGAAGG + Intronic
1119610409 14:76056960-76056982 GAGACAGAATGGGTAGTGGGAGG - Intronic
1121193509 14:92049509-92049531 GAAAAAGAACTGGAATTGGAAGG + Exonic
1121539272 14:94712902-94712924 CACACAGCACTGCTTGTGGAGGG + Intergenic
1122846985 14:104505526-104505548 GGCCCAGAAATGGTAGTAGAAGG - Intronic
1125425718 15:39547400-39547422 GACACAGAAGTGGGATTGGTGGG - Intergenic
1128600093 15:68988791-68988813 GAAAAAGAACTGGAATTGGAAGG - Intronic
1128772033 15:70290027-70290049 AAGACAGAACTGGTGGAGGAAGG + Intergenic
1129183275 15:73890282-73890304 GACTCAGAGCTGGTCCTGGATGG - Intergenic
1131690284 15:94820086-94820108 GGCACAGAACTGGTAGGGGATGG - Intergenic
1133992423 16:10718720-10718742 AATAATGAACTGGTAGTGGATGG + Intergenic
1134657163 16:15955697-15955719 GACAGAGATTTGCTAGTGGAGGG - Intronic
1136424931 16:30163637-30163659 GAACCAGAACAGGGAGTGGAGGG - Intergenic
1137299309 16:47131995-47132017 ATAACAGTACTGGTAGTGGAAGG - Exonic
1137497741 16:48983787-48983809 GCCACAGAGCTGGAAGGGGAGGG + Intergenic
1138105392 16:54284953-54284975 GACTCAGGACCGGTAGTGGCCGG + Exonic
1138546479 16:57722615-57722637 CACAGAGAACGGGCAGTGGATGG + Intronic
1139646793 16:68337506-68337528 GACACAGAGCTGATCGGGGAGGG + Exonic
1142677299 17:1521795-1521817 GACACAGATCTGGAAATGTATGG - Intronic
1143064580 17:4235728-4235750 GACACAAAACTGCTAGCGGAAGG - Intronic
1145080861 17:19893220-19893242 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1145816689 17:27799920-27799942 GACACATAACTGGTAGAGCTAGG - Intronic
1147543494 17:41380498-41380520 GACACAGAAGTGGCAGGGCAGGG - Intronic
1148725226 17:49784455-49784477 GAGACTGAACTGGAAGTGGTAGG - Intronic
1149540384 17:57463795-57463817 TGCACAGAACTGGTGTTGGAGGG - Intronic
1149582689 17:57762259-57762281 GACACAGCCCTGGAAGTGGGTGG - Intergenic
1150362952 17:64553766-64553788 AACACAGAGCTGCTAGTTGAAGG + Intronic
1151712377 17:75814085-75814107 GACACAGAACTGGAAGCAGAGGG - Intronic
1151886339 17:76925246-76925268 GACACGGAAGTGGCAGGGGAGGG - Intronic
1152426710 17:80221981-80222003 GACACTGAGCTGGTTATGGAGGG + Intronic
1152453684 17:80400442-80400464 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1152670350 17:81600492-81600514 GACCTAGAGCTGGAAGTGGAAGG - Intronic
1155961750 18:32001169-32001191 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1158134875 18:54197213-54197235 GACACAGAAGTGGAAGTCGGAGG - Intronic
1158539483 18:58339844-58339866 GACACATTGCTGGTAGTGCAGGG + Intronic
1158576907 18:58645783-58645805 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1159564170 18:70029557-70029579 GTCACACAACTGGTAATTGATGG - Intronic
1159970581 18:74647570-74647592 GAAACAGAACAGGGAGAGGAAGG - Intronic
1161686922 19:5707541-5707563 GACACACAGCTGGGTGTGGATGG + Intronic
1162261792 19:9539966-9539988 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1162364987 19:10243101-10243123 GACACAGATCTGTTGGTGGGGGG - Intergenic
1163624335 19:18380318-18380340 AACTGAGAGCTGGTAGTGGAGGG + Intronic
1163671118 19:18629305-18629327 CACACAGACCTGGTAGTGGGTGG + Intergenic
1164202701 19:23031617-23031639 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1164258550 19:23550108-23550130 GAAAAAGAACTGGAATTGGAAGG - Intronic
1167161093 19:47767508-47767530 GACACACAGCTGGTAAGGGATGG - Intergenic
1167360950 19:49030096-49030118 GACAAAGAAGTGTTGGTGGAGGG - Intronic
1167453866 19:49588309-49588331 TTTACAGAACTGGCAGTGGAGGG + Intronic
925434055 2:3820679-3820701 GAAAAAGAACTGGAATTGGAAGG + Intronic
925466927 2:4114185-4114207 CATACAGAACTTGGAGTGGAGGG + Intergenic
926803509 2:16683461-16683483 GAGACAGGATTGGGAGTGGAAGG + Intergenic
928969523 2:37013224-37013246 GATACTGAGCTGGTAGAGGAAGG + Intronic
932609020 2:73184865-73184887 GCCACAGAAGTGTCAGTGGAAGG + Intergenic
934974452 2:98790836-98790858 AACACAGAAATGGGCGTGGAGGG - Intergenic
934980884 2:98839033-98839055 GTTACAGAACTGACAGTGGAGGG + Intronic
935240993 2:101178183-101178205 GAGTCAGAACTGGAATTGGAAGG + Intronic
935747079 2:106197883-106197905 GTCACAGAGCTGGGAGTGTAGGG + Intergenic
936855670 2:116954293-116954315 GATACAGAGGTGGTAGTGGCAGG - Intergenic
936918869 2:117667650-117667672 GACACAGGACTGGCTGTGAAGGG + Intergenic
942322212 2:174745505-174745527 AATACAGAATAGGTAGTGGAAGG + Intergenic
942322724 2:174750073-174750095 GGCACAGCACTGGACGTGGAGGG + Exonic
942492456 2:176503511-176503533 GCAACAGAACAGTTAGTGGAGGG - Intergenic
943460385 2:188165673-188165695 GAAAAAGAACTGGAATTGGAAGG + Intergenic
946086617 2:217179988-217180010 GATCCAGAACTGGGAGGGGATGG - Intergenic
946169736 2:217887739-217887761 CACACAAAGCTGGAAGTGGATGG + Intronic
946241140 2:218356854-218356876 GACACAGACCGGGTAGAGGCAGG + Exonic
946595317 2:221299764-221299786 GTCACATAACTTGAAGTGGAAGG + Intergenic
946924064 2:224608952-224608974 GACACAGAACAGTTACTGGAAGG + Intergenic
948060863 2:235042565-235042587 GACACAAAACTGGGTGAGGATGG - Exonic
948834576 2:240619967-240619989 GACAGAGAGCTGGCAGTTGAAGG + Intronic
948846150 2:240683668-240683690 GACACAGAGCAGGTGGAGGAGGG - Intergenic
948847707 2:240691060-240691082 GACACAGAGCAGGTGGAGGAGGG + Intergenic
949036449 2:241817693-241817715 GACACTGGACTGGTCCTGGAAGG - Intergenic
1169031804 20:2415383-2415405 GAAACAGAACTGGAATGGGATGG + Intronic
1170680647 20:18522421-18522443 GAAAAAGAACTGGAATTGGAAGG + Intronic
1172334078 20:34099532-34099554 GACACCTAACTGGCATTGGAGGG - Intronic
1172618781 20:36306654-36306676 AAGACAGAACTGGCAGGGGAGGG - Intronic
1173651762 20:44670893-44670915 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1174011056 20:47449938-47449960 AACACAGAGCTGGTTGTGCATGG - Intergenic
1175252588 20:57618376-57618398 GTCACAGCACTTGTAGGGGAGGG + Intronic
1175489660 20:59371350-59371372 GACACAGGACTGGTGGTGCAGGG - Intergenic
1177799728 21:25816643-25816665 GACTCAGAAATTGTATTGGAAGG - Intergenic
1178279759 21:31271443-31271465 GACACAGACCTGCAGGTGGAAGG - Intronic
1179890386 21:44332209-44332231 GACACACAACAGATGGTGGAGGG + Intronic
1179987557 21:44930078-44930100 GACTCAGAACTGGAAGAGGGAGG - Intronic
1180057838 21:45368043-45368065 GACACAAACCTGGGAGTGGAGGG + Intergenic
1182869262 22:33632087-33632109 GACACAGGACTGTTAGGAGAAGG - Intronic
1183124067 22:35758268-35758290 GACACAGACTTGGTAGAGAATGG + Intronic
1183313124 22:37122300-37122322 GACGCAGGTCGGGTAGTGGAGGG - Intergenic
1183347599 22:37316550-37316572 GACGCAGAGCAGGCAGTGGAGGG + Intergenic
1183635879 22:39062315-39062337 GAAAAAGAACTGGAATTGGAAGG + Intronic
1185233257 22:49695174-49695196 GCCACAGAACCGGGCGTGGAGGG + Intergenic
951894654 3:27599634-27599656 GAAAAAGAACTGGAATTGGAAGG - Intergenic
952379856 3:32796243-32796265 GAAAAAGAACTGGAATTGGAAGG + Intergenic
952597573 3:35037054-35037076 GACAGAGAACTGGGAATGGAGGG - Intergenic
953060670 3:39426476-39426498 GACACAGGACTGGGACTGGCAGG + Intergenic
957604521 3:82379926-82379948 GACACACAACCAGTAGTGGAGGG - Intergenic
959552714 3:107681156-107681178 GACACAGAAATATTAATGGAAGG + Intronic
959664505 3:108905707-108905729 AACACAGAACTAGTAATGGCAGG - Intergenic
960697825 3:120413216-120413238 CACAGAGCACTGGAAGTGGATGG + Intronic
961712978 3:128841352-128841374 GAAAAAGAACTGGAATTGGAAGG + Intergenic
961726774 3:128935984-128936006 GACAGAGAGCTGGCAGTGAAAGG + Intronic
963282776 3:143402052-143402074 GTCTCAGAACTGTAAGTGGAAGG + Intronic
965752928 3:171995844-171995866 GACCCAGAGCTGGCAGAGGAAGG + Intergenic
966398662 3:179525736-179525758 GAAAAAGAACTGGAATTGGAAGG + Intergenic
966863402 3:184242881-184242903 GACGTAGAACTGGTAGTGGAGGG + Exonic
968048573 3:195637956-195637978 GACACAAAACTGGTAGAGCCAGG - Intergenic
968098836 3:195951669-195951691 GACACAAAACTGGTAGAGCCAGG + Intergenic
968306039 3:197651968-197651990 GACACAAAACTGGTAGAGCCAGG + Intergenic
968413517 4:408666-408688 GAAAAAGAACTGGAATTGGAAGG + Intergenic
969115489 4:4868417-4868439 GACACAGACCTTTTACTGGAAGG + Intergenic
970629572 4:17925473-17925495 GATACAGAAGGGGTAGTAGAAGG + Intronic
971117813 4:23668336-23668358 GAGACAGAACTGGTAGGATATGG + Intergenic
971995002 4:33954615-33954637 GGCACAGAGCTAGTAGTTGAAGG - Intergenic
973149964 4:46875138-46875160 TACAAAGAACTGGTAGTGAAAGG - Intronic
973246483 4:48016200-48016222 GAGACAGAACGGAGAGTGGATGG + Intronic
973750918 4:54020711-54020733 GAAAAAGAACTGGAATTGGAAGG - Intronic
975151862 4:71032115-71032137 GAAAAAGAACTGGAATTGGAAGG - Intergenic
976507840 4:85869935-85869957 GTCACAGTACTGGTAGGGTAGGG - Intronic
977371514 4:96143037-96143059 GACACAGAAGTGGAAATGGGTGG + Intergenic
977470887 4:97440527-97440549 AGCACAGAACTGGTGGTTGATGG - Intronic
978303435 4:107295227-107295249 GAAAAAGAACTGGAATTGGAAGG + Intergenic
979267993 4:118725796-118725818 GACACAGAAAGTATAGTGGAAGG + Intronic
982640139 4:157948487-157948509 GACACAAAATTGGATGTGGAGGG + Intergenic
983151065 4:164282177-164282199 GATACAGAAGTAGTAGTTGAGGG - Intronic
984411512 4:179404109-179404131 GAAAAAGAACTGGAATTGGAAGG - Intergenic
984885834 4:184448731-184448753 TGCAGAGAACTGGTGGTGGAGGG - Intronic
985505051 5:274439-274461 GACACAAAACTGGTAGAGCCAGG - Intronic
985655850 5:1131005-1131027 GACACAGAACAGGGAGGGGGTGG + Intergenic
985743067 5:1631196-1631218 GACACAAAACTGGTAGAGCCAGG + Intergenic
986178961 5:5375952-5375974 GACACAGAACTGGTAGTGGAGGG + Intergenic
989261379 5:39423412-39423434 GACACAGAACCTGGAGTGGGCGG + Intronic
990451912 5:55941649-55941671 GACACAGCAGTGGTATTGGGGGG - Exonic
994324617 5:98435151-98435173 GAAAAAGAACTGGAATTGGAAGG - Intergenic
995059060 5:107794320-107794342 GACACAGAACTATCAGAGGATGG + Intergenic
998769545 5:145526344-145526366 GACACAAAACCTGTAGTGAAGGG + Intronic
1001003560 5:168030066-168030088 GACACAGGGCAGGTACTGGATGG + Intronic
1001622174 5:173096464-173096486 GACACAGAAAGGGGAGGGGAGGG - Intronic
1001665065 5:173425855-173425877 GTCACAGAACTGGGTATGGATGG + Intergenic
1002074188 5:176698344-176698366 GGGACAGAACAGGTGGTGGAGGG + Intergenic
1003966002 6:11252862-11252884 GACACAGAAATGGAAGTGATAGG + Intronic
1005591913 6:27337473-27337495 GACAGAGAAGTTGAAGTGGAAGG + Intergenic
1007185434 6:39967142-39967164 GACACTGCACTGATAGGGGAAGG - Intergenic
1007831914 6:44645443-44645465 GACACAAATCTGGTTGTGAAGGG - Intergenic
1011989656 6:93498469-93498491 GAAACAGAAGGGGTAGTGGAGGG - Intergenic
1015765256 6:136709536-136709558 GGCACAGAAATGGAAGTGGCAGG + Intronic
1016981950 6:149862440-149862462 GGCACAAAAATGGTAGTGGTTGG - Intronic
1017269582 6:152490942-152490964 GAAAAAGAACTGGAATTGGAAGG - Intronic
1017390288 6:153931235-153931257 GTCACAGAGCTGGTAGTGGGAGG - Intergenic
1017923165 6:158888528-158888550 GAAAAAGAACTGGAATTGGAAGG + Intronic
1018555250 6:165042722-165042744 GACAAAAAACTAGCAGTGGACGG + Intergenic
1018632361 6:165832245-165832267 GAGACAGAAGTGGTGGTGGGAGG + Intronic
1018901339 6:168053336-168053358 GAAACAGAGCTGGCAGTGGGAGG - Intergenic
1021660402 7:22914031-22914053 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1021858353 7:24880390-24880412 GAGGCAGGACTGGTAGGGGAGGG - Intronic
1022036486 7:26539610-26539632 GAAACACAACTGGTCATGGAGGG - Intergenic
1022425344 7:30263462-30263484 GACCCAGGAGTGGTAGGGGAGGG - Intergenic
1022518357 7:30989612-30989634 GGCACAGCACTGGTTGTGGCGGG - Intronic
1023531651 7:41162871-41162893 GGCACAGAAATGGTTGTGGAAGG + Intergenic
1024482220 7:49875615-49875637 GCCACAGAGCTGATACTGGAAGG - Intronic
1026023976 7:66730927-66730949 GGCACAGAACTGGCAGGGGTGGG + Intronic
1026856993 7:73761745-73761767 GAAACAGACCTGGAAGGGGAAGG + Intergenic
1027958663 7:84916034-84916056 GAAACAGGAGTGGGAGTGGAAGG + Intergenic
1028353533 7:89879069-89879091 CACACAGTACTGCTAGGGGATGG + Intergenic
1028403009 7:90445162-90445184 GCCACAGGACTGGAAGTGAATGG + Intronic
1028590111 7:92484594-92484616 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1029997247 7:105018874-105018896 TACACTAAACTGGAAGTGGATGG + Intronic
1030274741 7:107708769-107708791 GCCACAGAGCTGGTAATGTATGG + Intronic
1030457194 7:109791042-109791064 AATACAGAATTGGTAGTAGAAGG - Intergenic
1031984620 7:128155497-128155519 GACACAGGACTTGTGGTGGGTGG - Intergenic
1033084503 7:138329912-138329934 GAAAAAGAACTGGAATTGGATGG - Intergenic
1035396375 7:158537655-158537677 GACACAGAGCAGGACGTGGAGGG + Intronic
1036549413 8:9803567-9803589 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1038057997 8:23880226-23880248 TACCCAGAACTGATAGAGGATGG + Intergenic
1038734199 8:30154758-30154780 GAAACAGAACTAGTAGTAGATGG - Intronic
1040095894 8:43442066-43442088 GACAAAGAACTGATTGTGGTGGG - Intergenic
1041325775 8:56662501-56662523 GATACAGAATGGGAAGTGGAAGG - Intergenic
1042042418 8:64606720-64606742 CACACATAACTGGTACTGGAAGG - Intronic
1043097731 8:75996949-75996971 GACACATAACTGGTGGTGAGAGG + Intergenic
1046074690 8:109301723-109301745 GACAAAGAGCTGGAATTGGAAGG - Intronic
1049808953 8:144554630-144554652 GTGACAGAGCTCGTAGTGGAAGG - Intronic
1052747723 9:32457172-32457194 GACACTGTACTCGAAGTGGAAGG - Exonic
1053069649 9:35093533-35093555 GACACACTGCTGGTAGTGGCTGG - Exonic
1053133931 9:35637568-35637590 GAAAAAGAACTGGAATTGGAAGG - Intronic
1054834866 9:69666497-69666519 ATCACAGAACTTTTAGTGGAAGG - Intronic
1056030395 9:82547363-82547385 TACACAGAACTGATAGTTGAAGG + Intergenic
1056363503 9:85881591-85881613 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1056391671 9:86146717-86146739 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1057720465 9:97527963-97527985 GCGACAGACCTGGGAGTGGAGGG + Intronic
1059824286 9:118009721-118009743 AACTCAGGAATGGTAGTGGAGGG - Intergenic
1061669197 9:132179150-132179172 GACAGAGACCTGGTTGGGGAGGG - Intronic
1186271708 X:7896001-7896023 CACACAGAGCAGGTACTGGAAGG + Intergenic
1187103979 X:16221627-16221649 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1188890844 X:35610007-35610029 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1191806013 X:65134465-65134487 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1192260045 X:69500566-69500588 GACAGAGCACTGGTAGAGGCAGG + Intergenic
1192785572 X:74331666-74331688 TGCTCAGAACTGGTAGTAGAGGG + Intergenic
1192914343 X:75637060-75637082 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1192936062 X:75859415-75859437 GAAAAAGAACTGGGACTGGAAGG + Intergenic
1199838989 X:151624472-151624494 GTCACAGAGCTGGTAGGGAAAGG - Intronic
1200008038 X:153100817-153100839 GAAAAAGAACTGGAATTGGAAGG + Intergenic
1200812599 Y:7501226-7501248 GAAAAAGAACTGGAATTGGAAGG - Intergenic
1201534289 Y:15028700-15028722 GACACAGAAGTTGCAGTGAATGG - Intergenic