ID: 986178992

View in Genome Browser
Species Human (GRCh38)
Location 5:5376121-5376143
Sequence GAGGGTAAACAGCAAGAGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 325
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 288}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986178983_986178992 -1 Left 986178983 5:5376099-5376121 CCCCCATCCTGGGCCACCAGTAG 0: 1
1: 0
2: 3
3: 23
4: 307
Right 986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG 0: 1
1: 0
2: 2
3: 34
4: 288
986178989_986178992 -8 Left 986178989 5:5376106-5376128 CCTGGGCCACCAGTAGAGGGTAA 0: 1
1: 0
2: 0
3: 14
4: 91
Right 986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG 0: 1
1: 0
2: 2
3: 34
4: 288
986178986_986178992 -4 Left 986178986 5:5376102-5376124 CCATCCTGGGCCACCAGTAGAGG 0: 1
1: 0
2: 2
3: 22
4: 191
Right 986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG 0: 1
1: 0
2: 2
3: 34
4: 288
986178984_986178992 -2 Left 986178984 5:5376100-5376122 CCCCATCCTGGGCCACCAGTAGA 0: 1
1: 0
2: 0
3: 21
4: 150
Right 986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG 0: 1
1: 0
2: 2
3: 34
4: 288
986178985_986178992 -3 Left 986178985 5:5376101-5376123 CCCATCCTGGGCCACCAGTAGAG 0: 1
1: 0
2: 0
3: 11
4: 118
Right 986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG 0: 1
1: 0
2: 2
3: 34
4: 288
986178980_986178992 23 Left 986178980 5:5376075-5376097 CCTTCATCAGTGACAAGATACAT 0: 1
1: 0
2: 0
3: 14
4: 171
Right 986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG 0: 1
1: 0
2: 2
3: 34
4: 288

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986178992 Original CRISPR GAGGGTAAACAGCAAGAGCA AGG Intergenic
900018678 1:171833-171855 GAGGGGGAACAGCATGAGCCAGG + Intergenic
900951483 1:5860431-5860453 GACGGGGAACAGCAGGAGCAGGG + Intergenic
902977311 1:20098294-20098316 GGGAAGAAACAGCAAGAGCAAGG - Intergenic
903820028 1:26094961-26094983 GTGGATGAACAGCAAGATCAGGG + Intergenic
905812466 1:40922775-40922797 GAGGGTAGGCAACATGAGCAAGG - Intergenic
905892001 1:41523594-41523616 GGGGCCAAGCAGCAAGAGCACGG + Intronic
906312910 1:44766689-44766711 GAGGGTGAACAGCCAGGGTATGG + Intronic
907999117 1:59663222-59663244 GAGGTCAAACAGCTAGAGTATGG + Intronic
909905846 1:81193573-81193595 GAAGCAAAACAGCAAGAACATGG + Intergenic
910034882 1:82777722-82777744 AAGGGTGAGCAGCAACAGCACGG + Intergenic
911047233 1:93638673-93638695 CATGGTAAACAGCAGGAGGAAGG + Intronic
911474302 1:98357442-98357464 GAGGGTAAGCAGCAGCAGCATGG - Intergenic
914850522 1:151310606-151310628 GTGGGTAAAAAAAAAGAGCAGGG - Intronic
914981507 1:152418689-152418711 GAAGGTAAAGACCAAGATCATGG - Intergenic
916126882 1:161579625-161579647 GAGGGGAAAGAGGAAGAGTATGG - Intergenic
916136801 1:161661429-161661451 GAGGGGAAAGAGGAAGAGTATGG - Intronic
916180125 1:162076213-162076235 GAGGGTAGACAGCAGGACAAGGG - Intronic
920662333 1:207926028-207926050 GAAAGTAAACATCAAGAGCTGGG + Intergenic
921137113 1:212271494-212271516 TAAGGGAAACAGCATGAGCAAGG - Intergenic
921692476 1:218165691-218165713 GAGGAGAAACAGCCAGAGGACGG + Intergenic
922681376 1:227599959-227599981 GAGGGTAGACAGCAAAAGGATGG - Intronic
923230569 1:231982813-231982835 GAGGGTACATCGTAAGAGCAAGG + Intronic
923981170 1:239325884-239325906 GAGGGTAAATGGTAAGAGAAAGG + Intergenic
1063537080 10:6893886-6893908 GAGGGTAGTCAGCAAGAGAATGG - Intergenic
1064110649 10:12535791-12535813 GTGGGTAAACAGTAACTGCATGG - Intronic
1066194874 10:33089558-33089580 GAGGGTAAAACTCAAGAGGAAGG - Intergenic
1067201145 10:44172936-44172958 GAGACCACACAGCAAGAGCATGG - Intergenic
1068894236 10:62181751-62181773 AAGAGGAAACAGCAAGTGCAAGG + Intergenic
1069336837 10:67361524-67361546 TTGGGTAAACAGCAAAATCAAGG + Intronic
1069839665 10:71331713-71331735 TAGGGGAAACAGGCAGAGCAGGG - Intronic
1071947315 10:90659772-90659794 GAGGAAATAGAGCAAGAGCAAGG + Intergenic
1072411955 10:95210991-95211013 GAGGGAAAAGAGGAAGAGCAGGG + Intronic
1073066749 10:100764921-100764943 GGAGGTAAACAGGAAGAGGAGGG + Intronic
1073249943 10:102115059-102115081 GAGAGGAAAGAGGAAGAGCAAGG + Intronic
1073260823 10:102188882-102188904 AAGGCCAAGCAGCAAGAGCAGGG + Intergenic
1074614545 10:115054103-115054125 GAGGGCAAAGAGGAAGAGGAGGG - Intergenic
1075162038 10:120032847-120032869 GAAGGAAAACAGCAGGGGCAAGG + Intergenic
1075258105 10:120940938-120940960 AAGGGAAAACAGAAAGAACAAGG - Intergenic
1076598452 10:131640602-131640624 AATGGAAAACAGAAAGAGCAGGG + Intergenic
1077606123 11:3613929-3613951 GGAGGGAGACAGCAAGAGCATGG + Intergenic
1080733645 11:34987140-34987162 AAAGGTAAACAGTAAAAGCAAGG - Intronic
1081019158 11:37921823-37921845 GAAGGTAAACAGAAAGAGGCAGG - Intergenic
1081250652 11:40828700-40828722 GAGGGTAAACAGCTTGATCTAGG - Intronic
1081912366 11:46707973-46707995 AAGTGTAGACAGCAGGAGCAGGG + Intergenic
1081957440 11:47105748-47105770 GAGGGTAGGAAGTAAGAGCATGG - Intronic
1082868019 11:57917602-57917624 GATGGTAAAGAGGATGAGCAAGG + Intergenic
1084482467 11:69429930-69429952 GAGGGTATGCAGCCAAAGCAGGG - Intergenic
1084612432 11:70212181-70212203 GAGAGGAAACAGCAGGGGCAAGG - Intergenic
1084972693 11:72780476-72780498 GAAGGGAAAGAGCAAGAGCAGGG + Intronic
1085478953 11:76806119-76806141 GAGGGGAAAAAGAGAGAGCAGGG - Intergenic
1087515437 11:99154176-99154198 GTGGGGAAGCAGCAGGAGCAGGG + Intronic
1088762995 11:112949857-112949879 GAGGGTAAGGAGCAAGAGGTGGG + Intergenic
1089780697 11:120871412-120871434 GAGGGCAAAGGGGAAGAGCAGGG + Intronic
1092755043 12:11755472-11755494 GAGGGCAAACAGCAAGAGCCTGG - Intronic
1094845696 12:34360475-34360497 GAAGGGAAACAGAAACAGCAAGG - Intergenic
1094852740 12:34389529-34389551 GAAGGAAAACAGAAACAGCACGG + Intergenic
1096402604 12:51319620-51319642 AAGGAGAAAGAGCAAGAGCAAGG + Intronic
1096474545 12:51900246-51900268 GAGGGTAAGGAGAAACAGCAAGG - Intergenic
1096924646 12:55130139-55130161 GAGGGCAAAGAGAAAGAGCTGGG - Exonic
1098020667 12:66152349-66152371 GAGGGCAAACAGCAAAATTAAGG + Exonic
1100308745 12:93375617-93375639 GAGGAAAAACAGCAACACCAAGG - Intergenic
1100804521 12:98267579-98267601 GAGGGAAAAGAGCAAGAGAAAGG + Intergenic
1101574322 12:105983451-105983473 CATGGAGAACAGCAAGAGCAAGG + Intergenic
1105790022 13:23789704-23789726 GAGGGTCAACAAGAAGGGCATGG - Intronic
1106859835 13:33893918-33893940 GAGGGAGTTCAGCAAGAGCAAGG + Intronic
1107077478 13:36338667-36338689 AAGGGTAAAAACCAAAAGCAGGG + Intronic
1107230987 13:38110213-38110235 GAGGGTAAAGAGCGGGAGAAGGG + Intergenic
1107252828 13:38385993-38386015 GAAGGAAAACAGAAAGAGTAGGG + Intergenic
1107438611 13:40404069-40404091 GAAAGTAAACACCAAGAGAAAGG + Intergenic
1107671390 13:42749941-42749963 GATGGTAAACAGCAGCAGGATGG - Intergenic
1108426207 13:50303975-50303997 GAGGGTAGAGAGCAGGAGGAAGG - Intronic
1111320059 13:86615252-86615274 GAGAGTAAACAACAACAGAATGG - Intergenic
1112793849 13:103032835-103032857 AAGGGTAAATAGCAAAACCAAGG + Intergenic
1112910629 13:104479124-104479146 GAGGGCATTGAGCAAGAGCAAGG - Intergenic
1116916338 14:50529781-50529803 GAGAGGAAATAGCAAGAACAAGG + Intronic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1118291232 14:64526355-64526377 GAGGGCAAGAAGCAACAGCAAGG - Intronic
1118509354 14:66453958-66453980 GAGGGTAGAGAGCAAGGGGAGGG + Intergenic
1118583170 14:67325242-67325264 GAGGGTGAAGAGGAAGAGGAAGG - Intronic
1118914946 14:70095007-70095029 GAGGGTAAGCAGCTAGTTCAAGG - Intronic
1119616100 14:76100111-76100133 GAGGCAAAAAAGCAAGAGCATGG - Intergenic
1119894599 14:78209254-78209276 CAGGTGAAACAGGAAGAGCATGG + Intergenic
1120827511 14:88969058-88969080 AAGGGGAAACAGCAGGAACAAGG - Intergenic
1121006970 14:90496593-90496615 GAGGGTGCGCAGCAGGAGCAGGG - Intergenic
1122355551 14:101121033-101121055 GAGGGTCACCAGGAAGTGCACGG - Intergenic
1123443684 15:20306762-20306784 GAGGATCCAGAGCAAGAGCAGGG - Intergenic
1123699446 15:22903592-22903614 GATGGGGAGCAGCAAGAGCAGGG + Intronic
1126863535 15:52912441-52912463 GAGGATAAACAGAAAGCACAGGG - Intergenic
1127257713 15:57306218-57306240 GAGGGTAAGTAGGAAGCGCAGGG - Intergenic
1127294353 15:57596705-57596727 GAGGGGAAACAGCACAGGCACGG - Intronic
1127525462 15:59788041-59788063 GTGGGTTAGCAGCAAGAGGAGGG + Intergenic
1130096603 15:80860860-80860882 GAGGGAACACAGAAAGAGAAGGG - Intronic
1130334657 15:82948701-82948723 CAGGGGAAACAGCAAGTGCAAGG + Intronic
1130886100 15:88093955-88093977 GAGGGCAAACAGCCTCAGCAAGG + Intronic
1131105689 15:89732766-89732788 GAGGGGGAGAAGCAAGAGCATGG - Intronic
1133101041 16:3480113-3480135 GAATGTAAACAGTAAGACCATGG + Intronic
1134755439 16:16663318-16663340 GAGGATTAACAGAAAGAGGAAGG + Intergenic
1134990627 16:18695852-18695874 GAGGATTAACAGAAAGAGGAAGG - Intergenic
1135101011 16:19605588-19605610 GAAAGAAAACAGCAAGTGCAAGG - Intronic
1137776877 16:51062710-51062732 GAGGTTGAACAGGCAGAGCATGG - Intergenic
1137871043 16:51950613-51950635 GAGGGAAAAGAGCATGAGAAGGG + Intergenic
1140544992 16:75799115-75799137 GAGGGTAAAATCCAAGATCAAGG + Intergenic
1141675927 16:85517312-85517334 GAGGTTAAGCAGCAGGACCAAGG - Intergenic
1142388850 16:89784896-89784918 GAACGTAAACAGGAAGACCAGGG + Exonic
1142930836 17:3282853-3282875 TGGGGAAAACAGCATGAGCAAGG - Intergenic
1143025478 17:3939195-3939217 GAGGGTCAACATCAAGGTCAGGG + Intronic
1143393885 17:6576704-6576726 CAGGGCCAACAGCAAGAGGAAGG - Intergenic
1143411322 17:6711184-6711206 GAGGGTACACAGCACGGGCAGGG - Intronic
1143625155 17:8105640-8105662 GAGGGTAAGAAGCCAGAGCATGG + Intronic
1145253557 17:21310411-21310433 GAAGGAAAACAGCAGGAACAAGG - Intronic
1145900528 17:28488021-28488043 GAGGGTAAACAGCTTGCTCAGGG - Intronic
1147127261 17:38379992-38380014 GGTGGTAACCAGCAAGAGTAGGG + Intronic
1148455881 17:47811161-47811183 GAGGGTCATCAGCAAGGGCTGGG - Intronic
1148992232 17:51676281-51676303 GAGGGTGAACATCTAGAGCCAGG + Intronic
1149190625 17:54057201-54057223 TAGGGCACAGAGCAAGAGCACGG + Intergenic
1149398704 17:56271632-56271654 GAGGGTGACCAGGAAGGGCAGGG + Intronic
1151108778 17:71650874-71650896 AAGGGTTACCTGCAAGAGCATGG + Intergenic
1152543443 17:80988835-80988857 GAAGGAGAAGAGCAAGAGCAAGG - Intergenic
1153469443 18:5427648-5427670 CAGGACAAACAGAAAGAGCATGG + Intronic
1155671480 18:28377089-28377111 GAGTGTGAAAAGCCAGAGCATGG - Intergenic
1156259178 18:35428738-35428760 GATGGTAAAAATCAAGAGCCAGG + Intergenic
1157892075 18:51427408-51427430 GAGGGGAAACAGGGAGGGCATGG - Intergenic
1158646342 18:59251205-59251227 GTGTGTAAACAGCAAGAGCCTGG + Intergenic
1158661150 18:59388837-59388859 GAGGTTAAACAGAAAGAGTGTGG + Intergenic
1158729201 18:60003912-60003934 GAGGGGCAACAGCCAGAGCTGGG - Intergenic
1159943416 18:74426120-74426142 GAGGCAAAACAGGAAGACCAGGG - Intergenic
1161079532 19:2303602-2303624 GAGGATATGGAGCAAGAGCATGG + Intronic
1162265844 19:9573546-9573568 GAGGGAATGCAGCAAGTGCAAGG + Intronic
1164709269 19:30343864-30343886 GAGGGAAAACAGCAAGAGGTTGG + Intronic
1164791591 19:30989991-30990013 GAGGTCACACAGCAAGATCATGG + Intergenic
1166519506 19:43471072-43471094 GAGGTTACACAGCAAGAGGGTGG - Intergenic
1167223666 19:48221032-48221054 GAGGGAAAAAAGAAAGAGGAAGG + Intronic
1167764754 19:51474392-51474414 GAGGGTGGACAGTAAGAGGAGGG - Intergenic
1168651879 19:58097258-58097280 GAGAGGAAGGAGCAAGAGCAGGG + Intronic
926716787 2:15930798-15930820 GAGGGAAAAGACCAAGAGCATGG - Intergenic
927483508 2:23472854-23472876 GAGGGTTAAAAGCAAGACCCTGG - Intronic
928325016 2:30312404-30312426 GAAGAGAAACAGCAATAGCATGG + Intronic
928601653 2:32909410-32909432 CAAGGCAAACAGCAAGACCAAGG - Intergenic
929241702 2:39660140-39660162 CAGAGTAAACAGCCAGTGCAAGG - Intergenic
929269111 2:39953457-39953479 CAGGGAAAACAGTAAGAGAAAGG + Intergenic
929979008 2:46661676-46661698 ATGGGTAAACAGCAAGGGCAGGG + Intergenic
931065164 2:58578121-58578143 GCAGGGAAACAGCAAGTGCAAGG + Intergenic
932799620 2:74729358-74729380 GAGGGAATTGAGCAAGAGCAAGG - Intergenic
934107856 2:88712506-88712528 GAGGGTGAACTGTGAGAGCAAGG - Intronic
934126573 2:88898743-88898765 GTGGGAAAACAGCACCAGCAAGG + Intergenic
936087974 2:109482455-109482477 GAAGATAAACAGCCACAGCACGG - Intronic
937120704 2:119438362-119438384 GAGGGGGAACAGCGAGAGCTTGG + Exonic
938286242 2:130120167-130120189 CAGGGGGAGCAGCAAGAGCAAGG - Exonic
940066302 2:149633693-149633715 GAGGTTAAACATCAACACCAAGG - Intergenic
941684610 2:168435805-168435827 TAGGGAAAACAGTAAGATCAAGG - Intergenic
942326228 2:174779093-174779115 GAGGGAAAACAGCAAGGCCTTGG - Intergenic
944173166 2:196801158-196801180 GAGAATAAACAGCAAAAGGATGG + Intergenic
944634107 2:201657841-201657863 GAGAGTAAGGAGCATGAGCAGGG - Intronic
945660652 2:212681496-212681518 GAGGGTAAACATCATGAGGCAGG + Intergenic
947170486 2:227306174-227306196 ATGGGGCAACAGCAAGAGCAAGG + Intronic
947454859 2:230244826-230244848 GAAGGAAAACAGGCAGAGCAAGG + Intronic
948462515 2:238137200-238137222 CAGGGGAAAGAGCAGGAGCAGGG + Intergenic
948550077 2:238765340-238765362 CAGGGTAATCAGGAAGGGCAAGG - Intergenic
1168756432 20:321618-321640 CAGAGGAAACAGCAAGTGCAAGG - Intergenic
1168955229 20:1829865-1829887 GAGGGGCGACAGCAAGAGGAAGG + Intergenic
1169816330 20:9660733-9660755 AAGAGTCAACAGCAAGTGCAAGG + Intronic
1169933537 20:10858692-10858714 CAGTGGAAACTGCAAGAGCAGGG + Intergenic
1170142793 20:13141937-13141959 GTAGGTAAGCAGCAACAGCAAGG - Intronic
1170418748 20:16171421-16171443 GAGGGAAAGCAGAAAGAGAAAGG + Intergenic
1170723153 20:18901889-18901911 ATGGGTAAAGACCAAGAGCATGG - Intergenic
1170930175 20:20762549-20762571 GAGGGCACAGAGCAAGAGAAGGG - Intergenic
1171309345 20:24134147-24134169 GAGGGGTGACAGAAAGAGCATGG + Intergenic
1171953691 20:31443005-31443027 TGGGGAAAACAGCAAGTGCAAGG + Intronic
1172623838 20:36336332-36336354 CAGAGGAAACAGCAAGCGCAAGG - Intronic
1174286742 20:49479461-49479483 CAGCGGAAACAGCAAGTGCAAGG + Intronic
1174983912 20:55428201-55428223 GAGGGGAGACAGGAAGAGGAAGG + Intergenic
1175214025 20:57380701-57380723 GAAGGTAAACAGCAAGGGCCAGG + Intergenic
1175498517 20:59432499-59432521 GAGGGTTCACAGCAACAGGATGG + Intergenic
1178742153 21:35211491-35211513 GAGGGTAAGCAGCAAGGGGCTGG - Intronic
1179582718 21:42353595-42353617 AAGGATAAACAGAAAGAGGAGGG - Intergenic
1181086152 22:20440357-20440379 GAGGGTGAGGCGCAAGAGCATGG - Intronic
1182550934 22:31100426-31100448 GAGGGAAACCAGAAAGAGAAGGG - Intronic
1182821711 22:33222309-33222331 GAGGGTTACCAGCATGAGCCTGG + Intronic
1184272870 22:43394797-43394819 GAGGTTAAACAGCATGACCAAGG + Intergenic
1184752152 22:46492895-46492917 GAAGGTAGACAAAAAGAGCATGG + Intronic
1185330593 22:50250552-50250574 CAGGGTCACCAGCAGGAGCAGGG + Intronic
949131686 3:509940-509962 AAGGGAAAACAGAAAAAGCAGGG - Intergenic
949506231 3:4730655-4730677 GAGGGTGAACAGCAAGACCCTGG - Intronic
949842777 3:8338142-8338164 GAGGTTTAACAGCAGGAGCCTGG + Intergenic
950863830 3:16173566-16173588 GGGGGCAAAAAGCAGGAGCAGGG - Intergenic
951590860 3:24262817-24262839 GACGGTAAACACCATGAGGAAGG + Intronic
952002089 3:28797769-28797791 GCAGGTAAACAGGAAGGGCATGG + Intergenic
952214934 3:31268882-31268904 GAGATTAAACATCAAGAGAAAGG + Intergenic
952741362 3:36737996-36738018 GAGGAGACCCAGCAAGAGCATGG - Exonic
952946916 3:38484101-38484123 GAGCATTAACAGCAAGAGCGGGG + Exonic
953214170 3:40902218-40902240 GAGGGCAGACAGCAAGAGGCAGG + Intergenic
953417697 3:42732357-42732379 GAGTGTTGACAGCAGGAGCATGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954766471 3:52922073-52922095 GAGGTTATACAGCTTGAGCAAGG - Intronic
955796220 3:62639892-62639914 AAGAGGAAACAGCAAGTGCAAGG - Intronic
955874121 3:63472324-63472346 GAGGTTAAACAGCAAGTCCAAGG - Intronic
956249392 3:67219790-67219812 GAGGCTAAACAAGAAGAGAAGGG + Intergenic
956262682 3:67362257-67362279 GAGGGAGAACAGCATGTGCAAGG - Intronic
957175513 3:76802983-76803005 GAGCGTAAACTTCAAGATCATGG + Intronic
957398389 3:79675557-79675579 GAGGGTAAAGAGAAATACCAAGG + Intronic
959679899 3:109082826-109082848 GAGGGAATAAAGCAAGAGCAAGG + Intronic
959774877 3:110146418-110146440 GAGAGCAAACAACAATAGCATGG - Intergenic
959823638 3:110767330-110767352 GAGCATAAGCAGCAAGAGCTTGG + Intergenic
961546761 3:127639637-127639659 GCAGGTAAACAGCAGCAGCATGG - Intronic
961786609 3:129351102-129351124 CAGAGGAAACAGCATGAGCAAGG - Intergenic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962991830 3:140584503-140584525 GAGGGGAAAAAGAAAGGGCATGG + Intergenic
963255066 3:143136735-143136757 AAAGGTGAACAGTAAGAGCATGG - Intergenic
963317111 3:143771710-143771732 GAGGGACAACAGCAGGAGCACGG - Intronic
963507556 3:146206342-146206364 AAGGGGAAACAGCAAGTACAAGG - Intronic
964519676 3:157551143-157551165 GAGGGTATTGAGCAAGAGCATGG - Intronic
965417678 3:168417268-168417290 GAGGGTAAAAGGGAAGAGCAGGG + Intergenic
966834879 3:184041655-184041677 GAATTAAAACAGCAAGAGCAAGG + Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
968471871 4:786237-786259 GGCGGTAAACAGCAAGAGAAAGG + Exonic
968912182 4:3482045-3482067 GAGGGTAAGAGGAAAGAGCATGG - Intronic
969179952 4:5432474-5432496 GATGGGAAACAGGAATAGCAAGG + Intronic
969690495 4:8701552-8701574 GAGGGAAAACAGGAGGAGCTGGG + Intergenic
971216333 4:24665545-24665567 GAGGGAAAAGAGAAAGAACAAGG - Intergenic
973922654 4:55704557-55704579 CAGGGCAAACAGCAAGGACAAGG + Intergenic
974095028 4:57353511-57353533 GAGGGTAAACAGCATAGCCAAGG - Intergenic
975126982 4:70793952-70793974 TAGGGTAGACAGCAAGAAAAGGG + Intronic
976136168 4:81938214-81938236 GAGGGAACTGAGCAAGAGCAAGG + Intronic
976886284 4:89988671-89988693 GAAGGTAGACAACAAGATCAGGG - Intergenic
977141167 4:93374315-93374337 GTGAGGAAACAGCAATAGCAGGG + Intronic
978016236 4:103749833-103749855 GAAGGAAAACAGGAGGAGCAGGG - Intergenic
979016311 4:115438303-115438325 GAGAGTAATCAGCAACAACAGGG + Intergenic
984595706 4:181664801-181664823 GAGGGCAGAGAGCAAGAGCGGGG - Intergenic
986056221 5:4139507-4139529 GAGGTTAAATAACATGAGCAAGG + Intergenic
986166301 5:5274345-5274367 GAGGATGAACAGGCAGAGCATGG - Intronic
986178992 5:5376121-5376143 GAGGGTAAACAGCAAGAGCAAGG + Intergenic
986229241 5:5846635-5846657 GAGGGTAAAAGGTAAGAGGAGGG - Intergenic
986346847 5:6843748-6843770 GAGGCTAAAAAGGAAGAGGACGG + Intergenic
988099760 5:26660997-26661019 GAGGGAAGAGAGCAAGAGCAGGG + Intergenic
988784031 5:34549434-34549456 GAAGGTAACCAGCAAAAGTATGG + Intergenic
990805953 5:59662094-59662116 CAGGGTAAAGAGCAAGAGGCTGG - Intronic
992144043 5:73826930-73826952 GAGGATAAACAGCAACTCCAAGG - Intronic
995511856 5:112918510-112918532 GAGAGGAAACAGCAAGAGAAAGG + Intronic
997306362 5:132839825-132839847 GAGGCTGCGCAGCAAGAGCAGGG - Intergenic
998377685 5:141702130-141702152 GAGGTCATACAGCAAGAGCCAGG - Intergenic
998842703 5:146272752-146272774 GAGGGAAATCATAAAGAGCAAGG + Intronic
998874979 5:146590123-146590145 GAGGGAAAACAGCAAGCCCCGGG - Exonic
999115004 5:149155178-149155200 GATGGTAAAAAGGAGGAGCAGGG - Intronic
1001041910 5:168342243-168342265 GAGGGAAAACATAAAGATCAGGG + Intronic
1001044735 5:168363081-168363103 GAGGGTAGAGAACAAGAGGAAGG + Intronic
1002694424 5:181075024-181075046 GCGGGAAAAAAGCCAGAGCAGGG + Intergenic
1003015993 6:2468031-2468053 GAGGGTAGACAGAGAGAGAAAGG + Intergenic
1003016013 6:2468122-2468144 GAGGGTAGACAGGGAGAGGAAGG + Intergenic
1003016031 6:2468213-2468235 GAGGGTAGACAGAGAGAGGAAGG + Intergenic
1005481212 6:26257280-26257302 GAGGGTAAGGAGCAAGTGCAAGG + Intergenic
1005758438 6:28946342-28946364 GAAGGAAAAGAGCAAGAGAATGG + Intergenic
1006824328 6:36923321-36923343 GAGGGGAAATAGCAAGAGGAAGG - Intronic
1007147982 6:39656581-39656603 CAGGTTAAACAGCTAGAGAAAGG - Intronic
1008050474 6:46895642-46895664 GAGGCAAAACAGCAAGAGAGGGG - Intronic
1008237899 6:49072580-49072602 GAGCGTAAACAGCCAGGGTAGGG + Intergenic
1010535113 6:77017227-77017249 CAGAGGAAACAGCAAGAGAAGGG + Intergenic
1010603243 6:77856648-77856670 GAGTGTAAATTGCAAGAGCGTGG + Intronic
1011859408 6:91736550-91736572 CAGATAAAACAGCAAGAGCATGG + Intergenic
1012677411 6:102134506-102134528 GATGGTAGAAAGCAAGAGAAAGG + Intergenic
1012705138 6:102516487-102516509 GAGGTAAAACTGGAAGAGCAAGG - Intergenic
1013726814 6:113108110-113108132 GAGGGCAAAAGGCAAGAGGAGGG - Intergenic
1013864505 6:114679078-114679100 GAGGGTAAAAAGCATCTGCATGG + Intergenic
1015106891 6:129547492-129547514 GAGGTTTTACAGCAAGAGAAAGG + Intergenic
1015167702 6:130216783-130216805 TAGGCTAAGCAGCAATAGCAGGG + Intronic
1015199809 6:130566537-130566559 GAGGAGAAAGAGCAAGAGCAAGG + Intergenic
1016256013 6:142106246-142106268 GAGGCAAAACAGGGAGAGCAGGG + Intergenic
1016327048 6:142914761-142914783 AAGGGAAACCAGCAAGAACATGG + Intronic
1016696849 6:147006204-147006226 GAAGGTAGACAGTAAGAGGAGGG - Intergenic
1017269066 6:152484979-152485001 GAGGAAAAACAGCAACAGTATGG + Intronic
1017934022 6:158988477-158988499 GAGGGAATTGAGCAAGAGCAAGG - Intronic
1019809380 7:3153552-3153574 GAGGAAAAAAACCAAGAGCAAGG - Intronic
1023103783 7:36744843-36744865 CAGGTTAAACTGCAAGTGCATGG - Intergenic
1023311767 7:38894800-38894822 GAGGCTAGACAGCAAGAAAATGG + Intronic
1023737625 7:43248766-43248788 GAGGGGAAACAGGAGGAGAACGG - Intronic
1027470606 7:78568961-78568983 TAGGGCAAACAGCAAGTGAAAGG - Intronic
1028214431 7:88114331-88114353 GATGGGCAACAGCTAGAGCATGG + Intronic
1029188715 7:98756952-98756974 GAGGGTAAAAAACTAGCGCATGG + Intergenic
1029189466 7:98761487-98761509 CAGGGGAAACAGCCAGTGCAAGG + Intergenic
1032429988 7:131852859-131852881 GAATGAAAACAGGAAGAGCAAGG - Intergenic
1034469274 7:151246950-151246972 GAAGGAAAACAGCAAGCCCAAGG - Intronic
1035212037 7:157336167-157336189 GATGGTGACCAGCAGGAGCAGGG - Intronic
1036453069 8:8885623-8885645 GAAGGAAAACAGCAAAAGGAAGG + Intronic
1036505958 8:9356293-9356315 GAAGGCAAAAAGAAAGAGCAGGG - Intergenic
1037702076 8:21284454-21284476 GAGGATGAAGAGGAAGAGCAGGG + Intergenic
1038163165 8:25059833-25059855 GAGGGTAAAGGGCAAGAAGATGG - Intergenic
1038400003 8:27277387-27277409 GAGGGGAAAAAGAAAGAGGAGGG - Intergenic
1039383794 8:37112123-37112145 GAGGGTAAATGGCAGGAGGAGGG + Intergenic
1041339760 8:56832078-56832100 GAGCCTAAAAAGGAAGAGCAAGG - Intergenic
1042217474 8:66440562-66440584 GAGGCTAAAGAACAAGAACAAGG + Intronic
1044836276 8:96298524-96298546 AAGGGGAAACAGTAAGATCAAGG - Intronic
1046214271 8:111122520-111122542 AAAGATAAACAGAAAGAGCAAGG + Intergenic
1047979418 8:130164993-130165015 GATGATAAACAGCATGAGAAAGG + Intronic
1048275177 8:133060476-133060498 GATGGTAAGCAGCCACAGCAGGG + Intronic
1049433039 8:142574095-142574117 CATGGGAAACACCAAGAGCACGG - Intergenic
1050247075 9:3701817-3701839 GAGGGTAGAGACCAAGAGAAGGG + Intergenic
1050668193 9:7965691-7965713 AGGGTTAAAAAGCAAGAGCAAGG - Intergenic
1051059971 9:13034464-13034486 GAGGGGAAACAGCAGAAGAATGG - Intergenic
1052558856 9:30057252-30057274 GAGCAAAAACAGGAAGAGCAAGG - Intergenic
1052849952 9:33372021-33372043 GAAGGTAAACAGCAGGAGACAGG + Intergenic
1053435481 9:38070860-38070882 GAGGGCAGACAGCAAGGCCAGGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1058110627 9:101028348-101028370 CAGGGTAGAAAGCAAGAGAATGG + Intergenic
1058836401 9:108861933-108861955 GAGCGTTAAGAGCAAAAGCAGGG - Intergenic
1059466523 9:114472169-114472191 GAGGGTAGATGGCAGGAGCAAGG - Intronic
1061771937 9:132931729-132931751 GAGGGTCTACAGTAAGTGCAAGG + Intronic
1062675353 9:137740037-137740059 GAGGGAAAAAAGCAAGTGCACGG - Intronic
1186791982 X:13008509-13008531 AAATGTAAACAGCAAGAGAAGGG - Intergenic
1187008445 X:15254851-15254873 GAGGGGAAACAGTCAGAGTAAGG + Intronic
1187802009 X:23074425-23074447 GAGGGTAAACAGTGGGAGGAGGG + Intergenic
1188209319 X:27401472-27401494 GAAGGGAAACTGCAAGAGAAAGG + Intergenic
1192510209 X:71716887-71716909 GAGGGTAAAGAGGGAGAGGAGGG + Intronic
1192516488 X:71764666-71764688 GAGGGTAAAGAGGGAGAGGAGGG - Intronic
1194703286 X:97142382-97142404 GAGAGAAAACAACATGAGCAAGG + Intronic
1194848815 X:98846826-98846848 GAGGGCATTGAGCAAGAGCAAGG - Intergenic
1195275116 X:103274337-103274359 GAGGGAAACCAGGAAAAGCAGGG - Exonic
1195581508 X:106509190-106509212 GAGGGAAAACAGGAAGAGTATGG - Intergenic
1196847210 X:119905684-119905706 CAGAGGGAACAGCAAGAGCAAGG - Intronic
1198217171 X:134566271-134566293 GAGAGTAGCCAGCAAGAGCAGGG - Exonic
1198254032 X:134909425-134909447 CAGAGTAAACAGCAAGAGCCAGG - Intronic
1198278598 X:135120483-135120505 GAGGGTAAACAGTAACAGCTTGG + Intergenic
1198292363 X:135252033-135252055 GAGGGTAAACAGTAACAGCTTGG - Intronic
1199582575 X:149375152-149375174 AATGGTAAACAGTAAGAGAATGG - Intergenic
1200287606 X:154838625-154838647 GTGGTTAAACAGCAACAGTAGGG + Intronic
1200372762 X:155744411-155744433 GTGGTTAAACAGCAACAGTAGGG + Intergenic
1200795749 Y:7339751-7339773 GAGTGCAATTAGCAAGAGCAAGG + Intergenic