ID: 986179100

View in Genome Browser
Species Human (GRCh38)
Location 5:5376700-5376722
Sequence AGATGGACACAAAACCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 198}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986179094_986179100 2 Left 986179094 5:5376675-5376697 CCAGGGGCATAGAACAGCCCCAT 0: 1
1: 0
2: 0
3: 16
4: 141
Right 986179100 5:5376700-5376722 AGATGGACACAAAACCAGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 198
986179093_986179100 8 Left 986179093 5:5376669-5376691 CCTCGGCCAGGGGCATAGAACAG 0: 1
1: 0
2: 0
3: 9
4: 144
Right 986179100 5:5376700-5376722 AGATGGACACAAAACCAGCTGGG 0: 1
1: 0
2: 2
3: 17
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986179100 Original CRISPR AGATGGACACAAAACCAGCT GGG Intergenic
900675949 1:3886343-3886365 TGAGGGACACAAAACCTTCTAGG - Intergenic
902629346 1:17695495-17695517 AGATGGACACAAGAGTGGCTTGG + Intronic
904252814 1:29237027-29237049 AGATGCACACACAACCCACTTGG - Intronic
906059221 1:42937495-42937517 AGATGGACACAGTCCCAGATGGG - Intronic
906249390 1:44299835-44299857 AGAGGGCCTCAGAACCAGCTGGG - Intronic
906750346 1:48252955-48252977 GGAAGGACACAAAACCAACTTGG - Intergenic
907774021 1:57495095-57495117 AGGAGTTCACAAAACCAGCTTGG + Intronic
908137605 1:61149287-61149309 AGATGCAAACAAAACAAACTTGG - Intronic
909271392 1:73627589-73627611 AGAAGGACACAAGACTGGCTGGG + Intergenic
910536234 1:88300938-88300960 ATTTGGAAACAAAACCTGCTTGG - Intergenic
912686931 1:111775266-111775288 GGCTGGACACAGAAACAGCTAGG + Intronic
914353785 1:146863441-146863463 AGATGGCAACAAAAGAAGCTGGG - Intergenic
915939574 1:160110270-160110292 ACATGCACACAAAATTAGCTGGG - Intergenic
916126759 1:161578238-161578260 AGATAGACACAGAATCAGGTAGG - Intergenic
916136678 1:161660078-161660100 AGATAGACACAGAATCAGGTAGG - Intronic
920386101 1:205570937-205570959 AGATGCACACCCACCCAGCTGGG + Intronic
921687289 1:218104566-218104588 AGCTGGACTCAAAATCAGTTGGG + Intergenic
922325117 1:224521149-224521171 AGATGGACAGAAAATCGACTTGG - Intronic
924052506 1:240092619-240092641 GGATGGACAAAGGACCAGCTCGG + Exonic
1063976597 10:11422689-11422711 AGTTGGCCACATAACCACCTAGG - Intergenic
1065436395 10:25707557-25707579 TGTTAGACACAAAACCAGCTGGG - Intergenic
1065552159 10:26878635-26878657 AAATGGACAAAAAAGCGGCTGGG - Intergenic
1065655900 10:27949616-27949638 AGATGAGCTGAAAACCAGCTGGG + Intronic
1066183687 10:32988033-32988055 AGAAGTACACAAAGCAAGCTGGG - Intronic
1066531750 10:36347942-36347964 ATATGGACACAAAACTAACAAGG - Intergenic
1070259598 10:74841834-74841856 AGATGTACTCAATACCAGATTGG + Intronic
1070650885 10:78235453-78235475 AGAGGGACACAAAACGTGCAAGG + Intergenic
1071381562 10:85068341-85068363 AGATAGACTCAAAACTAACTAGG + Intergenic
1071389065 10:85152201-85152223 AGAGGGATTCAAGACCAGCTTGG + Intergenic
1071731537 10:88253458-88253480 AGATGGACACAGAGGCTGCTGGG + Intergenic
1072328114 10:94318592-94318614 GGATGGACACAATTTCAGCTTGG - Intronic
1074412378 10:113239501-113239523 GAAAGGACACAAAACCACCTAGG - Intergenic
1076473334 10:130735428-130735450 ACATGGACACAGATCCAGATGGG + Intergenic
1077970188 11:7181376-7181398 AGGGGTACACAACACCAGCTGGG + Intergenic
1078242023 11:9538459-9538481 AGCTGGTCTCAAAACCTGCTGGG + Intergenic
1081643396 11:44773773-44773795 GGATGGACACAAGACCAGCCTGG + Intronic
1084199922 11:67549599-67549621 AGTTGGAAAAAAAATCAGCTGGG - Intergenic
1086269204 11:85039965-85039987 AGATGGAGAGAACACCATCTGGG + Intronic
1089878170 11:121746203-121746225 AGGTGGGCACAAATGCAGCTGGG + Intergenic
1090499725 11:127249656-127249678 AGCTGCACACAAACCCAGCCAGG + Intergenic
1092182088 12:6452928-6452950 AGAGGGACACAGAAACAGCTAGG + Intronic
1093642452 12:21542940-21542962 AGCAAGAAACAAAACCAGCTGGG - Intronic
1094096476 12:26710786-26710808 AGATGAACCCAAAGCTAGCTAGG + Intronic
1094256163 12:28429050-28429072 AGTTAGACCCAAAACCACCTTGG - Intronic
1094706930 12:32923249-32923271 TGATGGACACAGAACGAGTTTGG - Intergenic
1094839016 12:34335241-34335263 AGATGGAAAAAAAACCGGCGAGG + Intergenic
1096318325 12:50588722-50588744 AGTTTGGCACAAATCCAGCTAGG - Intronic
1102695937 12:114799613-114799635 AGACGGACTCAGAGCCAGCTTGG + Intergenic
1103553895 12:121754382-121754404 AGATGAACACAGAAGCAGGTAGG - Intronic
1103629939 12:122251951-122251973 AAATACACACAAAACCACCTGGG + Intronic
1104825692 12:131707727-131707749 GGATGGACTAAAAACCGGCTAGG - Intergenic
1106349900 13:28920612-28920634 AAAGGGACACAAACCCAGCTCGG - Intronic
1107538105 13:41356138-41356160 ACACGCACACAAAATCAGCTAGG - Intronic
1108248497 13:48541590-48541612 GGAAGGACACAATACCATCTAGG - Intergenic
1110130220 13:72000249-72000271 ATATGGGCACAAAAGCAGTTTGG + Intergenic
1111527567 13:89492215-89492237 ATGTAGACACAACACCAGCTGGG - Intergenic
1113202557 13:107883212-107883234 AAATACACACAAAGCCAGCTCGG - Intergenic
1113421406 13:110174219-110174241 TGATGGCCACAAAAACAGTTTGG + Intronic
1116108168 14:40538896-40538918 AGATGGAAACAAAACACACTGGG + Intergenic
1116992587 14:51291928-51291950 AGATGGCCACAGATCCTGCTGGG + Intergenic
1117009218 14:51453234-51453256 AGATGGATTCAAAACCAGAGAGG + Intergenic
1117182410 14:53204510-53204532 AAATGGACACAAAAGCAGGCAGG + Intergenic
1120837968 14:89057985-89058007 AGAGGGACACAAAACGACCGAGG - Intergenic
1121472581 14:94166780-94166802 ATTTGGACACAAAACCAGGGAGG + Intronic
1123161405 14:106281837-106281859 ACATGGTAACAAAAACAGCTTGG + Intergenic
1126107595 15:45156876-45156898 ACAGGGACACAGAATCAGCTCGG - Intronic
1126315008 15:47360928-47360950 AGATGGACCCAAATCCAGGTTGG - Intronic
1128082087 15:64862667-64862689 AGATGGGCACAAGACCTGGTGGG + Intronic
1128761916 15:70222878-70222900 AGACAGACACATAAACAGCTTGG - Intergenic
1129384103 15:75186040-75186062 AGAGGGACACAGAACCAGCCAGG - Intergenic
1132035743 15:98482491-98482513 AGCTAGTCACAAAACCAGATTGG + Intronic
1133129079 16:3665034-3665056 AGCTGGACACCCAACCAGCAGGG + Exonic
1137504534 16:49041572-49041594 AGGTAGACACACAACCAGCGTGG - Intergenic
1138137053 16:54532269-54532291 TGATCTACACAAAAACAGCTGGG + Intergenic
1139298758 16:65925962-65925984 AGATCTACACAGAGCCAGCTTGG - Intergenic
1139980235 16:70852080-70852102 AGATGGCAACAAAAGAAGCTGGG + Intronic
1140848514 16:78912545-78912567 TGTTGGAGACAAAACCAGCAGGG + Intronic
1146550862 17:33779480-33779502 AGTTAGATACAAAGCCAGCTAGG + Intronic
1148464452 17:47856626-47856648 AGATGGACAAAAGACCAGGAAGG + Intergenic
1148766128 17:50039273-50039295 AGAGGGACATAAACACAGCTGGG + Intergenic
1153972015 18:10235621-10235643 AGCTGAACCCAAGACCAGCTTGG - Intergenic
1155366520 18:25054628-25054650 AAATGGACAGAAAAAGAGCTTGG + Intergenic
1155368064 18:25068848-25068870 ATATTGACACAAAGCGAGCTGGG + Intronic
1157380384 18:47209574-47209596 GGATGGAAACAAAATCAGCATGG + Intergenic
1158799810 18:60893124-60893146 ACATACACACAAAACTAGCTGGG - Intergenic
1161116359 19:2499029-2499051 AAATGGAAACAGAACCGGCTGGG - Intergenic
1161130202 19:2584139-2584161 AGAAGGACACAGAGCCAGCTTGG + Intronic
1161136579 19:2623451-2623473 AGATGGACAGATAAACAGCATGG + Intronic
1161199212 19:3005310-3005332 AGATGGACACCACAGCAGATGGG + Intronic
1162236379 19:9312827-9312849 AGATAGACAAAAAGACAGCTGGG - Intergenic
1163104461 19:15115497-15115519 AGAGGAACACAAGCCCAGCTGGG + Intronic
1164894689 19:31862689-31862711 AGAAGGAAACAAAACCAAGTGGG + Intergenic
1167424457 19:49422994-49423016 AAATGGACAGAAAATCAGCAAGG - Intronic
1168657373 19:58140571-58140593 AAATGTACAAAAAATCAGCTGGG - Intronic
925385557 2:3459507-3459529 AGAAGGCCACAAAGCCAGTTTGG + Intronic
927668277 2:25047219-25047241 AGGTGAACACAAAACCAGAGCGG - Intronic
928292746 2:30053976-30053998 AGATGTATGCAAAACCAGATTGG + Intergenic
931578404 2:63745838-63745860 AAATGGGCACAAAAACAGTTTGG - Intronic
933498002 2:83075735-83075757 AGATGGACACAAATGCAGATAGG - Intergenic
934877919 2:97942827-97942849 AGAAGGACAAAAAACAGGCTGGG + Intronic
935386978 2:102510127-102510149 TGATGGAAACATCACCAGCTTGG - Intronic
936803294 2:116293546-116293568 AGAAGGATTCAAAAGCAGCTTGG - Intergenic
937027471 2:118711365-118711387 AGAGGGAGACAAAAGCAGCTTGG - Intergenic
937496740 2:122428573-122428595 AGAGGAAGAAAAAACCAGCTGGG - Intergenic
940752210 2:157638915-157638937 AGAAGGAAACAAAACCAGATAGG + Intergenic
940806663 2:158195032-158195054 AGATGGACCCAGGACCAGCATGG - Intronic
942430262 2:175903423-175903445 ACAAAGCCACAAAACCAGCTTGG + Intergenic
942574565 2:177349809-177349831 AGAGAGAGACAAGACCAGCTGGG + Intronic
942698480 2:178675513-178675535 AAATGGACACAACACAAACTTGG + Intronic
943329235 2:186539040-186539062 TGAAGAACACAATACCAGCTGGG - Intergenic
946501497 2:220252060-220252082 AAATGGACACCAAAGCAGCAGGG + Intergenic
947673004 2:231952423-231952445 AGATGGACAGATAAACAGATAGG - Intergenic
947956297 2:234195174-234195196 AGACAAACACAAAACCAGCATGG + Intergenic
947964429 2:234267588-234267610 AGATGGAGACAGATCCAGCTGGG + Intergenic
1172940377 20:38649891-38649913 ACATGGACACAGAGCCAGCAGGG - Exonic
1177007268 21:15689419-15689441 AGAAGGAAAGAAAACCAGTTTGG - Intergenic
1177842916 21:26254571-26254593 AGATGGAGACAACACGAACTAGG + Intergenic
1179146968 21:38776476-38776498 GGATGGCGAGAAAACCAGCTTGG + Intergenic
1180033134 21:45225872-45225894 AGATTGTCACAAAACACGCTAGG - Exonic
1183313416 22:37124003-37124025 AGAGGGACACTGGACCAGCTTGG + Intergenic
1184436861 22:44484464-44484486 AAATGAAAAGAAAACCAGCTGGG - Intergenic
1184837634 22:47033395-47033417 AGATGGACACATTCCCAGCCTGG - Intronic
949421678 3:3872663-3872685 ATATGGACACAAATGCAGGTGGG - Intronic
949944282 3:9177872-9177894 AGATGGACACACAACCAAGCAGG + Intronic
950481044 3:13243947-13243969 AGATGGCCACAAAAGCAGTTAGG + Intergenic
952560450 3:34586723-34586745 AAATGGCCACAAAGCCATCTGGG + Intergenic
953191570 3:40692303-40692325 ACATGGGCACAAAAACTGCTGGG - Intergenic
953322912 3:41988189-41988211 AAATGGACACAAAAAGAGATAGG + Intergenic
954664611 3:52245356-52245378 AGATGGGGACAAAATGAGCTGGG - Intergenic
955071426 3:55575518-55575540 TGATGGAAACAAACCCAGCAGGG + Intronic
956236854 3:67082201-67082223 AGATGGAAACATAATCAGATAGG - Intergenic
959024507 3:101224983-101225005 AGATGGACACAAATCCCTCTAGG - Exonic
960359687 3:116696895-116696917 AGATGGAAACTAAACTAGCAGGG - Intronic
961162816 3:124744032-124744054 AGATGTACAGAAAAGCTGCTTGG + Exonic
962993554 3:140602505-140602527 AGATGGGCCTAAAGCCAGCTAGG + Intergenic
963127485 3:141828581-141828603 AAATGGATACAAAACTGGCTTGG - Intergenic
965786582 3:172341228-172341250 ATATGGAAACAAAACCAACCTGG - Exonic
965962540 3:174445407-174445429 ACATGGGCACAAAACTACCTGGG - Intronic
966863875 3:184245590-184245612 AGATGTACACGAAACCAGCTGGG + Exonic
969524358 4:7696661-7696683 AGGTGGGCACCAAACCAACTGGG - Intronic
973257620 4:48128946-48128968 AGAGTGACACATAACTAGCTTGG + Intronic
973749501 4:53999455-53999477 AGATGTGCATAAAATCAGCTGGG - Intronic
974092143 4:57322400-57322422 AGATGGGGATAAAACAAGCTGGG + Intergenic
974438122 4:61882953-61882975 ACATGCACACAAAATTAGCTGGG + Intronic
975543680 4:75539616-75539638 AGTAGGAGACCAAACCAGCTGGG + Intronic
978405778 4:108377338-108377360 GGATGGACAAACAAGCAGCTGGG - Intergenic
978835457 4:113144285-113144307 AGATTGACAAAAAAGCAGCGTGG + Intronic
979606188 4:122641494-122641516 ATATGGACACAGATACAGCTAGG + Intergenic
980144758 4:128968346-128968368 AGATGGACTCAAAAATAGATTGG - Intronic
981583682 4:146275997-146276019 AGCTGGACACAAAATGAGGTAGG + Intronic
982858369 4:160414825-160414847 AGAAGGTCACAAAACCGGCTTGG + Intergenic
986179100 5:5376700-5376722 AGATGGACACAAAACCAGCTGGG + Intergenic
987014364 5:13802292-13802314 AGATGGTCAGAAAACCAGGTAGG + Intronic
987186027 5:15419920-15419942 ATATGTCCACATAACCAGCTGGG - Intergenic
987416310 5:17665231-17665253 ATATGGAACCAAAAACAGCTAGG - Intergenic
988894549 5:35657754-35657776 ATATGACCACAAAACCAGGTGGG - Intronic
991573103 5:68076067-68076089 AGTAAGACACAAAACCAGGTAGG + Intergenic
992273574 5:75091142-75091164 ACATGAATACAAAACTAGCTTGG + Intronic
993111099 5:83658260-83658282 TGATGGACACAAATCCATCCTGG - Intronic
993963395 5:94330177-94330199 TGAAAGACACAAAACCAGCAAGG + Intronic
994415242 5:99461674-99461696 AGAAAGACAGAAAACCAGTTAGG - Intergenic
994992795 5:107018340-107018362 AATTGGACACAATACAAGCTAGG - Intergenic
995071735 5:107930350-107930372 AGTTGGCCACAAGAACAGCTGGG - Intronic
996109345 5:119546690-119546712 AGCTGGACAAAAAACAGGCTAGG + Intronic
996827704 5:127703879-127703901 AGATGCACACACAAAAAGCTGGG + Intergenic
997798431 5:136834831-136834853 TGATGGAAACAAAATCAGATAGG + Intergenic
998396426 5:141821528-141821550 AGATGGGCAGAGGACCAGCTGGG - Intergenic
999709651 5:154306117-154306139 AGATAGACAGAAAATCAGCAAGG + Intronic
999709687 5:154306826-154306848 AGATAGACAGAAAATCAGCAAGG + Intronic
1001810139 5:174621376-174621398 AGGTGGGCAGAAAGCCAGCTGGG + Intergenic
1002534622 5:179869483-179869505 AGCTGGACCCAAAACCCACTAGG - Intronic
1003242191 6:4354369-4354391 ATATGGACACGAGTCCAGCTTGG + Intergenic
1003773365 6:9332672-9332694 AGAAGTACTCTAAACCAGCTTGG - Intergenic
1004186710 6:13427286-13427308 AAATGGTCAAAAATCCAGCTGGG + Intronic
1006604344 6:35245298-35245320 AGATGCACTCCACACCAGCTGGG - Exonic
1008417990 6:51265617-51265639 AGATGGCAACAAATCCAGCACGG - Intergenic
1009328199 6:62380475-62380497 AGCTGGTCAAAAAACCAGATAGG + Intergenic
1012636196 6:101545547-101545569 AGATTTACACAAATCTAGCTAGG - Intronic
1013420639 6:109963613-109963635 AGATGTAGCCAAAACCAGCCAGG + Intergenic
1014383990 6:120779186-120779208 AGATGGACAGAAACCCAGTCAGG - Intergenic
1015434661 6:133172333-133172355 AGATGTGCACACACCCAGCTGGG - Intergenic
1016165640 6:140939097-140939119 AGATTTCCACAAAACCAGCAAGG + Intergenic
1016359127 6:143249423-143249445 GCATGGACATAAAACCAGCCAGG + Intronic
1017678056 6:156835295-156835317 AAAAGTACACAAAACCAGTTAGG - Intronic
1018968518 6:168508126-168508148 AGCTGGACTCAAAGCCAGGTAGG - Intronic
1020573097 7:9890715-9890737 AGCAGGAGACAAAACCAGCCAGG - Intergenic
1021846486 7:24768076-24768098 TGCTGACCACAAAACCAGCTGGG - Intergenic
1023247936 7:38226660-38226682 GCATGGAGACAACACCAGCTGGG + Intronic
1023765962 7:43510978-43511000 AGAAGGCCACAAAGCCAGGTTGG - Intronic
1024242811 7:47448359-47448381 AGAGGAACATCAAACCAGCTGGG - Intronic
1026203382 7:68234446-68234468 AGTTGTACTCAAAACCAGATAGG + Intergenic
1029795982 7:102895165-102895187 AGAGGGATACTAACCCAGCTTGG + Intronic
1031712191 7:125062772-125062794 AGATGAAGCCAAAACCAGTTTGG + Intergenic
1032899921 7:136295597-136295619 AAATAGACAAAAAATCAGCTGGG - Intergenic
1040698831 8:50036533-50036555 AGATGAACAAGAAAACAGCTGGG - Intronic
1041433492 8:57810724-57810746 AGATAGACAGACAACCAACTAGG - Intergenic
1042374300 8:68031644-68031666 AGTTGGACAAAGAAGCAGCTAGG - Intronic
1043765944 8:84132471-84132493 ACATGTTCACAAACCCAGCTTGG + Intergenic
1044427142 8:92064990-92065012 AGATGCACACACATTCAGCTAGG - Intronic
1045837701 8:106542371-106542393 AGATGAACAAAAATCCATCTAGG - Intronic
1051805907 9:20992451-20992473 AGCTGCACACAGAACCAGGTGGG + Intronic
1055123613 9:72692388-72692410 AGATGAACACAAAATCAGCTAGG - Intronic
1055178127 9:73346534-73346556 AGAAGTACACAAAAAGAGCTAGG - Intergenic
1055797510 9:79990983-79991005 AGAAGCAAACAAAATCAGCTCGG - Intergenic
1057260795 9:93582128-93582150 GCATGGACACAGAAGCAGCTAGG + Intronic
1057588754 9:96353270-96353292 AAATGGATACAAAACCATGTAGG + Intronic
1057590510 9:96369127-96369149 AGATGGACACAAATGCAGCAAGG + Intronic
1060742869 9:126111096-126111118 GTGTGGACAGAAAACCAGCTGGG + Intergenic
1060922380 9:127430442-127430464 AGATGGGAACAAAAACTGCTGGG - Intronic
1186055498 X:5645285-5645307 CTATGGACACAAAACCAGGCAGG + Intergenic
1187353793 X:18546860-18546882 AGGAGTACACAAAACAAGCTGGG + Intronic
1189428485 X:40925189-40925211 AGCTAGACAGAAAACCAGCAAGG - Intergenic
1189762185 X:44333008-44333030 AGATGGAAATAAACACAGCTTGG - Intronic
1190036370 X:47028672-47028694 AGAATGACAAATAACCAGCTTGG - Intronic
1190250132 X:48717060-48717082 ACATGTACACAAAATCAGATTGG + Intergenic
1192126920 X:68509705-68509727 GGATGGACAGAAAACCATCCTGG - Intronic
1193980510 X:88176278-88176300 AGATGTGCACAACTCCAGCTTGG + Intergenic
1194132118 X:90094199-90094221 AGATGGACTCAAACCCAGGAAGG + Intergenic