ID: 986181858

View in Genome Browser
Species Human (GRCh38)
Location 5:5400536-5400558
Sequence TTCTGGGTTTTCTATGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181858_986181867 15 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181867 5:5400574-5400596 TGAGAGAGCAGTGGCGAGTTGGG No data
986181858_986181865 6 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181865 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
986181858_986181869 29 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181858_986181870 30 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181870 5:5400589-5400611 GAGTTGGGAGCGGAGACTCTGGG No data
986181858_986181868 20 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181858_986181866 14 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181866 5:5400573-5400595 TTGAGAGAGCAGTGGCGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986181858 Original CRISPR TTCTGGGTTTTCTATGAAGT GGG (reversed) Intergenic