ID: 986181859

View in Genome Browser
Species Human (GRCh38)
Location 5:5400537-5400559
Sequence CTTCTGGGTTTTCTATGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181859_986181867 14 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG No data
Right 986181867 5:5400574-5400596 TGAGAGAGCAGTGGCGAGTTGGG No data
986181859_986181865 5 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG No data
Right 986181865 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
986181859_986181866 13 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG No data
Right 986181866 5:5400573-5400595 TTGAGAGAGCAGTGGCGAGTTGG No data
986181859_986181868 19 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181859_986181869 28 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181859_986181870 29 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG No data
Right 986181870 5:5400589-5400611 GAGTTGGGAGCGGAGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986181859 Original CRISPR CTTCTGGGTTTTCTATGAAG TGG (reversed) Intergenic