ID: 986181860

View in Genome Browser
Species Human (GRCh38)
Location 5:5400552-5400574
Sequence AATGTCTTGGGGTGACTTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181860_986181870 14 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181870 5:5400589-5400611 GAGTTGGGAGCGGAGACTCTGGG No data
986181860_986181868 4 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181860_986181865 -10 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181865 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
986181860_986181869 13 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181860_986181871 30 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181860_986181866 -2 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181866 5:5400573-5400595 TTGAGAGAGCAGTGGCGAGTTGG No data
986181860_986181867 -1 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181867 5:5400574-5400596 TGAGAGAGCAGTGGCGAGTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986181860 Original CRISPR AATGTCTTGGGGTGACTTCT GGG (reversed) Intergenic