ID: 986181862

View in Genome Browser
Species Human (GRCh38)
Location 5:5400563-5400585
Sequence ACTGCTCTCTCAATGTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181862_986181873 29 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181873 5:5400615-5400637 CCTACAGAGAAGGCAGCTGTCGG No data
986181862_986181868 -7 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181862_986181869 2 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181862_986181871 19 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181862_986181870 3 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181870 5:5400589-5400611 GAGTTGGGAGCGGAGACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986181862 Original CRISPR ACTGCTCTCTCAATGTCTTG GGG (reversed) Intergenic
No off target data available for this crispr