ID: 986181863

View in Genome Browser
Species Human (GRCh38)
Location 5:5400564-5400586
Sequence CACTGCTCTCTCAATGTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181863_986181873 28 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181873 5:5400615-5400637 CCTACAGAGAAGGCAGCTGTCGG No data
986181863_986181869 1 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181863_986181870 2 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181870 5:5400589-5400611 GAGTTGGGAGCGGAGACTCTGGG No data
986181863_986181871 18 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181863_986181868 -8 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986181863 Original CRISPR CACTGCTCTCTCAATGTCTT GGG (reversed) Intergenic