ID: 986181864

View in Genome Browser
Species Human (GRCh38)
Location 5:5400565-5400587
Sequence CCACTGCTCTCTCAATGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181864_986181869 0 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181864_986181871 17 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181864_986181870 1 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181870 5:5400589-5400611 GAGTTGGGAGCGGAGACTCTGGG No data
986181864_986181868 -9 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181864_986181873 27 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181873 5:5400615-5400637 CCTACAGAGAAGGCAGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986181864 Original CRISPR CCACTGCTCTCTCAATGTCT TGG (reversed) Intergenic