ID: 986181868

View in Genome Browser
Species Human (GRCh38)
Location 5:5400579-5400601
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181864_986181868 -9 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181856_986181868 22 Left 986181856 5:5400534-5400556 CCCCCACTTCATAGAAAACCCAG No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181862_986181868 -7 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181858_986181868 20 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181857_986181868 21 Left 986181857 5:5400535-5400557 CCCCACTTCATAGAAAACCCAGA No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181860_986181868 4 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181861_986181868 3 Left 986181861 5:5400553-5400575 CCAGAAGTCACCCCAAGACATTG No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181863_986181868 -8 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data
986181859_986181868 19 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG 0: 1
1: 0
2: 2
3: 32
4: 223
Right 986181868 5:5400579-5400601 GAGCAGTGGCGAGTTGGGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type