ID: 986181869

View in Genome Browser
Species Human (GRCh38)
Location 5:5400588-5400610
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181859_986181869 28 Left 986181859 5:5400537-5400559 CCACTTCATAGAAAACCCAGAAG No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181864_986181869 0 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181858_986181869 29 Left 986181858 5:5400536-5400558 CCCACTTCATAGAAAACCCAGAA No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181862_986181869 2 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181857_986181869 30 Left 986181857 5:5400535-5400557 CCCCACTTCATAGAAAACCCAGA No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181861_986181869 12 Left 986181861 5:5400553-5400575 CCAGAAGTCACCCCAAGACATTG No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181860_986181869 13 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data
986181863_986181869 1 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181869 5:5400588-5400610 CGAGTTGGGAGCGGAGACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type