ID: 986181871

View in Genome Browser
Species Human (GRCh38)
Location 5:5400605-5400627
Sequence CTCTGGGTGACCTACAGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181864_986181871 17 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181860_986181871 30 Left 986181860 5:5400552-5400574 CCCAGAAGTCACCCCAAGACATT No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181862_986181871 19 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181861_986181871 29 Left 986181861 5:5400553-5400575 CCAGAAGTCACCCCAAGACATTG No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data
986181863_986181871 18 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181871 5:5400605-5400627 CTCTGGGTGACCTACAGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986181871 Original CRISPR CTCTGGGTGACCTACAGAGA AGG Intergenic