ID: 986181873

View in Genome Browser
Species Human (GRCh38)
Location 5:5400615-5400637
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986181864_986181873 27 Left 986181864 5:5400565-5400587 CCAAGACATTGAGAGAGCAGTGG No data
Right 986181873 5:5400615-5400637 CCTACAGAGAAGGCAGCTGTCGG No data
986181862_986181873 29 Left 986181862 5:5400563-5400585 CCCCAAGACATTGAGAGAGCAGT No data
Right 986181873 5:5400615-5400637 CCTACAGAGAAGGCAGCTGTCGG No data
986181863_986181873 28 Left 986181863 5:5400564-5400586 CCCAAGACATTGAGAGAGCAGTG No data
Right 986181873 5:5400615-5400637 CCTACAGAGAAGGCAGCTGTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type