ID: 986184067

View in Genome Browser
Species Human (GRCh38)
Location 5:5420273-5420295
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986184067_986184068 2 Left 986184067 5:5420273-5420295 CCAGCACAAATAGGTCATTTGCG No data
Right 986184068 5:5420298-5420320 AGAATTTAAAGACAGATGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986184067 Original CRISPR CGCAAATGACCTATTTGTGC TGG (reversed) Intergenic
No off target data available for this crispr