ID: 986186341

View in Genome Browser
Species Human (GRCh38)
Location 5:5444702-5444724
Sequence CTATCTAAATACATGTTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 338
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 318}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
986186341_986186343 23 Left 986186341 5:5444702-5444724 CCAAGAAACATGTATTTAGATAG 0: 1
1: 0
2: 2
3: 17
4: 318
Right 986186343 5:5444748-5444770 CGATGAAATTTTGTACATTAGGG 0: 1
1: 0
2: 0
3: 4
4: 111
986186341_986186342 22 Left 986186341 5:5444702-5444724 CCAAGAAACATGTATTTAGATAG 0: 1
1: 0
2: 2
3: 17
4: 318
Right 986186342 5:5444747-5444769 TCGATGAAATTTTGTACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
986186341 Original CRISPR CTATCTAAATACATGTTTCT TGG (reversed) Intronic
903803700 1:25989173-25989195 CTGTCTAAATACATGTCTTTGGG - Intronic
904999682 1:34658442-34658464 GTATAAAAATACATGTATCTGGG + Intergenic
906384832 1:45359036-45359058 ATATCTTAATACATATTTTTGGG + Intronic
907101572 1:51842368-51842390 ATATCTTACTACATGTTTATAGG - Intronic
907786059 1:57613964-57613986 GTATCTAAATACCTGTATATCGG + Intronic
908304281 1:62795320-62795342 CTATCTTAATGCATGGTTATTGG + Intronic
908394187 1:63710330-63710352 CTATTTTAATACAGCTTTCTTGG + Intergenic
908645648 1:66275262-66275284 GTATTGAAATACATGTTTCAGGG + Intronic
909177445 1:72379303-72379325 CAATCTAAATACATGTCTAGTGG - Intergenic
909193030 1:72578654-72578676 CTGACTCAATACATGCTTCTAGG - Intergenic
909399142 1:75206937-75206959 GTATCAAAATACATCTCTCTGGG - Intronic
910702064 1:90086311-90086333 CTTGCTAAATAAATGTTTCCAGG - Intergenic
912058948 1:105640527-105640549 ATATCCACATACATTTTTCTCGG - Intergenic
912188703 1:107312646-107312668 CTTTCTAAATACAGGTTCCTGGG + Intronic
913364896 1:118026502-118026524 ATATCTCAATAAATGTTTATTGG - Intronic
913409059 1:118530912-118530934 CTATGTACAGACATTTTTCTAGG - Intergenic
913419103 1:118643998-118644020 CTTACTAAAAACATTTTTCTGGG + Intergenic
913522497 1:119658744-119658766 ATATATACATGCATGTTTCTTGG + Intergenic
917779171 1:178373327-178373349 GTATCTAAATATATGTACCTAGG - Intronic
917885773 1:179382800-179382822 CTATATACATACACATTTCTTGG + Intronic
918968785 1:191384981-191385003 CAAACTAAAGAGATGTTTCTCGG - Intergenic
921895116 1:220391660-220391682 CTCTTTGAAAACATGTTTCTGGG + Intergenic
922094877 1:222434846-222434868 CTATCTAAAAATAGGTTTCAGGG - Intergenic
922368055 1:224884527-224884549 GAATGTAAATACATGTCTCTGGG + Intergenic
1063814801 10:9759474-9759496 CCATCTAAATGGATGTTCCTGGG - Intergenic
1064303037 10:14140005-14140027 CTACCTAAATTCAAGTCTCTAGG + Intronic
1065444489 10:25783848-25783870 CAAACTAAAGACATGCTTCTTGG + Intergenic
1067457766 10:46434209-46434231 CTACCTAAATACAGATTTTTAGG - Intergenic
1067629433 10:47950418-47950440 CTACCTAAATACAGATTTTTAGG + Intergenic
1067707419 10:48620123-48620145 CTATGAAAATACAGCTTTCTGGG + Intronic
1068584546 10:58782506-58782528 CTGTTAAAATACAGGTTTCTGGG - Intronic
1072016095 10:91348227-91348249 GTATATGAATACATTTTTCTTGG - Intergenic
1072440507 10:95449944-95449966 GTATCTAAAAATATTTTTCTTGG - Intronic
1072746829 10:97946102-97946124 ATTTCTCAATGCATGTTTCTAGG + Intronic
1073950326 10:108801155-108801177 TTACATAAATACATATTTCTAGG + Intergenic
1074804995 10:117040150-117040172 GTATCTAAAAACAGTTTTCTGGG - Intronic
1075342780 10:121660883-121660905 CTAGCTCAATACATGTTGGTGGG + Intergenic
1077745820 11:4903861-4903883 ATATCTGAATACATGTCTATGGG + Intronic
1078177676 11:8982370-8982392 CTATCTAGATAAACCTTTCTGGG - Exonic
1078399556 11:11012043-11012065 AGATCTTAATACATGTTTTTAGG + Intergenic
1079770823 11:24457307-24457329 TTCTCTAGATACAAGTTTCTGGG - Intergenic
1079843235 11:25429906-25429928 CTATTTAAATAAATGGTGCTGGG + Intergenic
1080695498 11:34600108-34600130 ATATCTAAGTACATTTTTCTAGG + Intergenic
1081402041 11:42654666-42654688 CTATTTAAAAAAATGGTTCTAGG - Intergenic
1082973697 11:59051220-59051242 CTTTCTAGTTACATGTTTATTGG - Intergenic
1082978092 11:59095032-59095054 CTTTCTAGTTACATGTTTATTGG - Intergenic
1083500940 11:63107163-63107185 CTATTTTAATAAATGTTGCTGGG - Intronic
1085667394 11:78426808-78426830 CTATTCAAACACATGTTACTAGG + Intergenic
1086794074 11:91078558-91078580 TTGTCAAAATACAGGTTTCTGGG - Intergenic
1086924915 11:92629891-92629913 CTATTAAAATACATATTTGTAGG + Intronic
1087459543 11:98427818-98427840 CTATCTAACTAAAATTTTCTGGG - Intergenic
1087916225 11:103814663-103814685 CTCTGTAAATAGATTTTTCTAGG + Intergenic
1088308082 11:108431222-108431244 CTATTTTAATAACTGTTTCTGGG - Intronic
1090271010 11:125386279-125386301 TTATAAAAATACATATTTCTAGG + Intronic
1091087747 11:132739318-132739340 CTCTGTAAATACATTTTTATGGG + Intronic
1092403753 12:8200382-8200404 CTATCTATATATTTTTTTCTTGG + Intergenic
1093221185 12:16422263-16422285 CTATCTATATATATTTATCTTGG + Intronic
1095828813 12:46560771-46560793 CTTTCTAAATATATTTTTGTGGG + Intergenic
1095964030 12:47854818-47854840 CTTTCTAAATACAGATTTCTGGG + Intronic
1097002157 12:55886100-55886122 ATTTCTAAATCCATGATTCTTGG - Intergenic
1097290024 12:57906796-57906818 GTATCTGAATACATGGGTCTGGG + Intergenic
1099064179 12:77952908-77952930 TTATATACATACATGTTTTTAGG + Intronic
1099630517 12:85136974-85136996 TTCTCTAAATACATCTTGCTTGG - Intronic
1100246824 12:92766539-92766561 CTTTTTAAAAACATGCTTCTGGG + Intronic
1100652725 12:96608386-96608408 CTCTCTATATACATGTTTAAAGG + Intronic
1100795833 12:98180967-98180989 CTATCTAAATAAATACTTTTCGG - Intergenic
1101108587 12:101463512-101463534 CTGTCTCGATTCATGTTTCTTGG - Intergenic
1101287622 12:103331791-103331813 CTATTTAATTCCATGTATCTAGG - Intronic
1101544022 12:105693431-105693453 ATATATAAATGCATATTTCTGGG + Intergenic
1103648540 12:122415132-122415154 CTATCTAAAAACTCGTATCTTGG + Intronic
1106547739 13:30744997-30745019 CATTCTGAATACATTTTTCTTGG - Intronic
1107174605 13:37385802-37385824 TTATAAAAATACATATTTCTTGG - Intergenic
1107903585 13:45042185-45042207 CTATCTAGAAAACTGTTTCTTGG + Intergenic
1108368185 13:49739344-49739366 CTCTCAAAATACATGTGTGTTGG - Intronic
1108406935 13:50113759-50113781 CCATTTAAAAACATGATTCTAGG + Intronic
1108485355 13:50918044-50918066 CTATCAACAACCATGTTTCTAGG - Intronic
1109017266 13:57033287-57033309 CTCTCTGAAGACATGTTTCATGG - Intergenic
1109230869 13:59756129-59756151 TTGTCAAAATACAGGTTTCTGGG - Intronic
1109251188 13:60022765-60022787 GAATGTAAATACATCTTTCTAGG + Intronic
1109563465 13:64079488-64079510 ATATATATATATATGTTTCTAGG + Intergenic
1110898169 13:80783629-80783651 ATATCTAAACTCATGTATCTAGG - Intergenic
1112833636 13:103485628-103485650 ATATATAAACACATGTTCCTGGG - Intergenic
1112888438 13:104203038-104203060 TTATCTATAAAAATGTTTCTGGG - Intergenic
1112900109 13:104347424-104347446 CTATGTAAATTCATCATTCTTGG - Intergenic
1112933990 13:104776582-104776604 ATATTTAAAGACATTTTTCTTGG - Intergenic
1113079772 13:106506476-106506498 ATACATAAATGCATGTTTCTTGG + Intronic
1114135721 14:19847391-19847413 GTATCTGAATTCATGTTACTTGG + Intergenic
1114149794 14:20025165-20025187 CTCTCTAGATACATATATCTAGG + Intergenic
1114185809 14:20401346-20401368 CTGTCTAAAGTCATGTTGCTGGG + Intronic
1114962199 14:27907269-27907291 ATCTATAAATACATATTTCTAGG + Intergenic
1115337214 14:32253842-32253864 CTATTTAAAAAAATATTTCTAGG + Intergenic
1116200067 14:41781986-41782008 TTCTCTAAATGTATGTTTCTTGG + Intronic
1116553404 14:46271420-46271442 CTTTATAAATACAGGATTCTTGG + Intergenic
1116600422 14:46915428-46915450 CTATATTTATACATGTTTATGGG - Intronic
1117891987 14:60432161-60432183 ATATCTATATACATGTTTGTTGG - Intronic
1118978153 14:70694987-70695009 GTATCCAAATCCATATTTCTGGG - Intergenic
1119689335 14:76658810-76658832 ATATCTAAATCATTGTTTCTGGG + Intergenic
1119710011 14:76814766-76814788 CTTTCAAAATACAAATTTCTAGG + Intronic
1119864623 14:77962974-77962996 CTGTCTATCTAGATGTTTCTTGG - Intergenic
1120206674 14:81594584-81594606 TTAACTAAATACATAATTCTGGG + Intergenic
1120591288 14:86375852-86375874 ATATATAAATATATGTTTATGGG - Intergenic
1120591290 14:86375890-86375912 ATATATAAATATATGTTTATGGG - Intergenic
1120591294 14:86375964-86375986 ATATATAAATATATGTTTATGGG - Intergenic
1121061254 14:90912187-90912209 CTATATAAATAAATGTTCTTAGG + Intronic
1124472264 15:29998593-29998615 ATACATAAACACATGTTTCTGGG - Intergenic
1125307322 15:38333803-38333825 CTATTTCAATAAATGTTGCTAGG - Intronic
1125396876 15:39258567-39258589 CTATTTAAATAAATGGTGCTGGG + Intergenic
1125933241 15:43614715-43614737 CTATCTAATTCCATTTTACTGGG + Intronic
1125946339 15:43714177-43714199 CTATCTAATTCCATTTTACTGGG + Intergenic
1126133895 15:45372031-45372053 TTTTCTAAAGACCTGTTTCTTGG - Intronic
1127169289 15:56282624-56282646 CTTTCTATATACATTTTTCCTGG - Intronic
1128798690 15:70482989-70483011 CCTTCTTAATACATGTTTCTTGG - Intergenic
1129217756 15:74110063-74110085 CTTTTTAAATACATGTATTTAGG + Intronic
1138259386 16:55603557-55603579 CTATTTAAATAAATGGTGCTGGG + Intergenic
1138937416 16:61745956-61745978 CTATCTAAACATATCTTCCTGGG - Intronic
1139090889 16:63645760-63645782 CTATCTAATTGCATGCTTATTGG - Intergenic
1139799347 16:69508917-69508939 CTATTTAAAAACATTTTTTTTGG + Intergenic
1140668634 16:77251641-77251663 TTTTCTAAATACAAGTATCTGGG - Intronic
1141048703 16:80741140-80741162 TTATGTATATATATGTTTCTGGG - Intronic
1146066183 17:29637439-29637461 CTTCCTTAATACATTTTTCTTGG + Intronic
1147219766 17:38921485-38921507 CTTTTTAAATACAGGTTTGTAGG - Exonic
1147521959 17:41181995-41182017 GAATCTAAATACACTTTTCTGGG - Intergenic
1150741944 17:67786154-67786176 CAATAAAAATAAATGTTTCTTGG + Intergenic
1151271121 17:72996754-72996776 CTCCCAAAATATATGTTTCTTGG - Intronic
1154459814 18:14570868-14570890 GTATCTGAATTCATGTTACTTGG + Intergenic
1155609043 18:27642584-27642606 ATAACAAAATACATTTTTCTAGG - Intergenic
1156254583 18:35383003-35383025 CTCTTGAAATATATGTTTCTAGG + Intergenic
1156578692 18:38350108-38350130 CCATCTTTATACATGTGTCTGGG + Intergenic
1156988473 18:43377674-43377696 CTATCTATACACATATATCTTGG - Intergenic
1157376832 18:47175286-47175308 CTATCTGAATAAACTTTTCTTGG + Intronic
1159257810 18:65971191-65971213 CAAGCTATATACATCTTTCTTGG - Intergenic
1159841193 18:73401170-73401192 GGATCGAAATACAAGTTTCTGGG - Intergenic
1161734188 19:5980524-5980546 CCATGTAAATACATGTGTCCTGG - Intergenic
1164103905 19:22086502-22086524 ATATAAAAATACATGTTCCTGGG - Intronic
1164839858 19:31384903-31384925 CTATCAAAAGACATATATCTGGG - Intergenic
927650517 2:24910587-24910609 GTATCTAAAAACATTTTCCTCGG - Intronic
928638574 2:33274076-33274098 TTTGCTAAATACATGTTTTTAGG - Intronic
928690701 2:33795608-33795630 CTATCTAAAAACATGACTTTAGG + Intergenic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
930236863 2:48896948-48896970 CAATTTAAATATATGTTTCAGGG + Intergenic
931466757 2:62495371-62495393 ATATTTAAACACATTTTTCTAGG + Intergenic
936797166 2:116220812-116220834 CTATGTCAATACATGTTTAAAGG - Intergenic
937878140 2:126841285-126841307 CTATATAACTACATGTTTTTTGG - Intergenic
938046321 2:128124593-128124615 ATAAATAAATACATATTTCTAGG - Intronic
938302345 2:130225786-130225808 TCATCTAAATACATATTGCTGGG + Intergenic
938578923 2:132628569-132628591 CTATCTATGCACATCTTTCTGGG + Intronic
938620241 2:133044460-133044482 CCATCTTATTACATGTTTATGGG - Intronic
939297383 2:140285762-140285784 CTTTCTAAATAAAAGTATCTGGG - Intronic
939849858 2:147291489-147291511 CTTTCTAAATATATGTTTTCTGG - Intergenic
940692819 2:156940759-156940781 ACATCCAAATACATGTTTCAGGG - Intergenic
940704946 2:157093081-157093103 ATATCTATCTACCTGTTTCTCGG + Intergenic
940934748 2:159478821-159478843 ATTTCTAAATACATGTTCTTTGG + Intronic
940941166 2:159562675-159562697 TTATCTAACTACAAGTTTTTAGG + Intronic
941938431 2:171006386-171006408 TTATCTGAAAACATGTTTTTTGG - Intronic
941976887 2:171415238-171415260 CTATGCATATGCATGTTTCTTGG - Intronic
942263837 2:174200355-174200377 CTATAAAAATACGTTTTTCTAGG + Intronic
943394167 2:187312127-187312149 CTACCTAAATACATATTTAGAGG + Intergenic
943558081 2:189429388-189429410 CTCTCTAATTACCTGTGTCTTGG + Intergenic
944449444 2:199826061-199826083 CCTACTAAATACATGTTTCCTGG + Intronic
945142855 2:206705593-206705615 CTTCCTAATTACTTGTTTCTTGG - Intronic
945565787 2:211397850-211397872 CTGGCTAAAGGCATGTTTCTGGG - Intronic
946094778 2:217264155-217264177 CTATTTAAATAAATCTTTCATGG - Intergenic
946862676 2:224014971-224014993 CTATCTGAAGACATTTTTTTTGG + Intronic
947035001 2:225842210-225842232 GTATCTATATGCATGTTTATAGG + Intergenic
947036219 2:225859869-225859891 ATACCTAAATAAATCTTTCTTGG - Intergenic
947167929 2:227281566-227281588 ATTTCTAAATACATTTTTCCAGG - Intronic
947224592 2:227827603-227827625 TTTTCTAAATACATGTTTTCAGG + Intergenic
947661183 2:231869836-231869858 CTCTCTGAATAAATGTTACTTGG - Intergenic
1174616419 20:51838947-51838969 CTATCTATATATTTTTTTCTGGG + Intergenic
1174732940 20:52935899-52935921 CTATCCGAATAGCTGTTTCTAGG - Intergenic
1176814302 21:13581958-13581980 GTATCTGAATTCATGTTACTTGG - Intergenic
1177441960 21:21137326-21137348 ATATGTAAATACATACTTCTTGG - Intronic
1177532892 21:22385731-22385753 TTATCTAATAAGATGTTTCTGGG - Intergenic
1182154114 22:28053020-28053042 CCAGCTAAATATTTGTTTCTAGG + Intronic
1183235888 22:36617237-36617259 CTATCTGGATAGATGTTCCTTGG + Intronic
949449876 3:4174022-4174044 CTAGCTAATTACATGATTCTGGG - Intronic
950381835 3:12622535-12622557 CTCTCTAAAGAGATGTCTCTTGG - Intronic
951472924 3:23075356-23075378 CTATCTAAATATAAGATTTTTGG - Intergenic
952622559 3:35363056-35363078 CTACATCAATATATGTTTCTAGG + Intergenic
953108005 3:39904552-39904574 CATTCTAAATACATGCTTTTGGG - Intronic
953559011 3:43970678-43970700 CTTTTTAAATACAGGTTTGTGGG + Intergenic
954580331 3:51699753-51699775 CTATGTAGATCCATGTGTCTGGG - Intronic
955880081 3:63534039-63534061 CTATTTAAATACAAGTTTCTAGG - Intronic
956591585 3:70921085-70921107 CCATGAAAATACATATTTCTAGG + Intergenic
956616283 3:71176102-71176124 TTATCCAAATACATTTTTGTTGG + Intronic
957225607 3:77441232-77441254 CAATCTTCAAACATGTTTCTTGG - Intronic
959365381 3:105451755-105451777 CTATTTTAATACAGCTTTCTTGG + Intronic
960229258 3:115205725-115205747 CTATATAAATACAATATTCTAGG - Intergenic
960274952 3:115718179-115718201 CTATCTTTCTATATGTTTCTGGG + Intronic
960289407 3:115865185-115865207 CTTTCTAAATATGTGATTCTTGG - Intronic
960295862 3:115943338-115943360 CCAGCTAGATACATCTTTCTTGG + Intronic
960382391 3:116979936-116979958 CTACCCAAATAAATGTCTCTTGG + Intronic
961848214 3:129787065-129787087 CTATCAAAAGTCATTTTTCTTGG + Intronic
962018130 3:131465533-131465555 TTTTCTACATACATGATTCTAGG - Intronic
963463525 3:145647839-145647861 ATAGTTAATTACATGTTTCTTGG - Intergenic
963695178 3:148557986-148558008 TCATCTAAATAAATGTTCCTGGG - Intergenic
964051621 3:152401018-152401040 CTATCTAAATAAGAATTTCTGGG + Intronic
964372535 3:156016003-156016025 CAATTTAAATACATGTAACTAGG + Intergenic
964832487 3:160900260-160900282 CAATCAAAATAAATGTTTGTTGG - Intronic
965822634 3:172699958-172699980 CTACCTAAATACATGTAACTTGG + Intronic
967823665 3:193861597-193861619 ATGTCTAAAAAGATGTTTCTTGG - Intergenic
969762299 4:9197386-9197408 CTATCTATATATTTTTTTCTTGG - Intergenic
970354137 4:15235657-15235679 CTGTTTAAATACATACTTCTTGG + Intergenic
971458226 4:26864696-26864718 ATATATAAAAACATGTTTCTTGG + Intronic
972156551 4:36170208-36170230 CTATCTGAATCAGTGTTTCTTGG - Intronic
973064943 4:45778193-45778215 CTCTCAAAATACATGTAACTTGG + Intergenic
973885958 4:55321820-55321842 CTATCCAAAAACATGTTTTCAGG + Intergenic
974335382 4:60537266-60537288 CTATCTACACACATGTACCTGGG + Intergenic
976976846 4:91176056-91176078 CTATCTAAACAAATGGTGCTGGG - Intronic
978608886 4:110514603-110514625 CAAGATAAATAAATGTTTCTAGG + Intronic
978849922 4:113322030-113322052 CTATCAAAATATCTGTTTTTTGG - Intronic
979072523 4:116226851-116226873 CTATCAATAGACATGTTTATTGG + Intergenic
979105267 4:116678056-116678078 CTATGTAGATACATATTTCCTGG + Intergenic
979438859 4:120727282-120727304 ATATATACATACATCTTTCTTGG - Intronic
979547473 4:121953797-121953819 CAAGCTAAATAAATGTTTGTTGG + Intergenic
979861307 4:125697036-125697058 CTATTTGAATTCATGTTTCTTGG - Intergenic
980582007 4:134767605-134767627 CTATGCATATACATGTTTTTGGG - Intergenic
980631450 4:135440581-135440603 CTATTTTATTACATGTTTTTTGG - Intergenic
980945746 4:139318986-139319008 ATATCTAAAAACATTTTTGTAGG + Intronic
981027728 4:140093726-140093748 CTATTTAAAGACATGAGTCTTGG - Intronic
981500696 4:145448568-145448590 CCATATAAATAAAAGTTTCTTGG + Intergenic
981986717 4:150865682-150865704 TTTCCTAATTACATGTTTCTAGG - Intronic
982600967 4:157448216-157448238 CTTTCTAAATTCATGCCTCTGGG + Intergenic
982875726 4:160646900-160646922 CTAGCTGTATACATGTTTGTAGG - Intergenic
982936170 4:161479122-161479144 GTATCTAAACACATTTTTATAGG - Intronic
982954846 4:161751329-161751351 CTTTTTGAATACATGTTTATAGG + Intronic
984089924 4:175360405-175360427 ATATTTAAATGCATATTTCTGGG - Intergenic
984246019 4:177275906-177275928 CTATCTGAATTCTTGTTTTTGGG - Intergenic
985096587 4:186418335-186418357 CTATCTTAATGCATGTTTAATGG + Intergenic
986186341 5:5444702-5444724 CTATCTAAATACATGTTTCTTGG - Intronic
987184884 5:15407218-15407240 CCATCTAAAGACATGTCTATAGG + Intergenic
989100335 5:37817307-37817329 CAATCCAAACACCTGTTTCTTGG + Intronic
989437320 5:41429946-41429968 CTATATAAATAGGTGTTTCCAGG - Intronic
989628672 5:43458400-43458422 CTTTTTAAAAACATATTTCTAGG - Intronic
992034184 5:72755234-72755256 CTATCAAAATTGATCTTTCTAGG + Intergenic
992419144 5:76584170-76584192 CTATATAAAAATATTTTTCTCGG - Intronic
993006993 5:82439388-82439410 CTATCTCTATTCATCTTTCTTGG - Intergenic
995115557 5:108474208-108474230 TTATATAATTACATATTTCTTGG - Intergenic
995134089 5:108661477-108661499 CTATCTAAATCCAAGATGCTTGG - Intergenic
996629490 5:125610410-125610432 ATAGCTAAATACATGGTTGTGGG + Intergenic
998505828 5:142671653-142671675 ATTTCTAAATTCATTTTTCTTGG + Intronic
1002802203 6:534604-534626 CTGGCTAAATACAGGATTCTTGG - Intronic
1002948150 6:1782220-1782242 CTTTTTAAATACATGTAACTGGG - Intronic
1003786531 6:9493129-9493151 CTTACTAAATATATGTTTCTTGG + Intergenic
1004421325 6:15472686-15472708 AGATCTAAATACAGGTCTCTTGG - Intronic
1005422740 6:25669650-25669672 ATATTCAAATACATCTTTCTTGG - Intronic
1006241803 6:32688075-32688097 ATATTTTAATATATGTTTCTAGG + Intergenic
1006241860 6:32688768-32688790 ATATTTTAATATATGTTTCTGGG - Intergenic
1006743357 6:36324635-36324657 ATATATATATATATGTTTCTAGG + Intronic
1008178316 6:48295330-48295352 CTACCTATATACATGTGTTTTGG + Intergenic
1009585940 6:65602101-65602123 GGATATAATTACATGTTTCTTGG + Intronic
1010771355 6:79835192-79835214 CTATGAAAAGACATGATTCTGGG + Intergenic
1010865269 6:80968657-80968679 CAAACTACATACATGTTTATGGG - Intergenic
1010871075 6:81040548-81040570 ATATATACATACATGTTTTTAGG - Intergenic
1011585642 6:88922247-88922269 ATATATAAATACATATTTATGGG + Intronic
1011923371 6:92610981-92611003 CTATCAAAATGCATCTTTCAAGG + Intergenic
1012252539 6:96994982-96995004 CTATTTTAATAAATGTTTGTGGG + Intronic
1012670058 6:102032937-102032959 CTATCTAAATATACATTTCATGG - Intronic
1013328847 6:109077372-109077394 CTATTTAAGTTCATCTTTCTGGG + Intronic
1013937556 6:115616515-115616537 CTGTCTAAATACTTCTCTCTTGG - Intergenic
1014362057 6:120490500-120490522 GTATCTTAATAGATGTTCCTGGG - Intergenic
1015087146 6:129309326-129309348 CTATCTAAACACATGGTTAATGG + Intronic
1016224984 6:141723883-141723905 CTCTATAAATCCATGTTGCTGGG + Intergenic
1016268909 6:142265489-142265511 CTTACTAGATAAATGTTTCTAGG + Intergenic
1017020008 6:150132578-150132600 ATAAATAAATACATTTTTCTGGG - Intergenic
1017870649 6:158483721-158483743 TTATTTAAATACACGTTCCTAGG + Intronic
1017885397 6:158595471-158595493 ATATCTAAATACAAGTCTTTTGG - Intronic
1018494241 6:164332261-164332283 CTTTGTAAATTCATATTTCTTGG - Intergenic
1018834927 6:167475829-167475851 CTTTCTAAAAATATTTTTCTTGG + Intergenic
1020419944 7:7991462-7991484 CTATCTAAATACATTTTACATGG + Intronic
1021059792 7:16097428-16097450 ATAGCTAAATATAAGTTTCTAGG - Intronic
1022043391 7:26602322-26602344 CTTTCTAAATCCTGGTTTCTGGG + Intergenic
1022318934 7:29269935-29269957 CTATCTACCTACCTGCTTCTGGG + Intronic
1023205053 7:37740117-37740139 TTATCTACATACATCTCTCTGGG + Intronic
1023297886 7:38735594-38735616 TGATCTAAATTGATGTTTCTGGG - Intronic
1023777925 7:43627500-43627522 CTATCTATATTCATGTATGTTGG - Intronic
1024714121 7:52055120-52055142 CAAACTAAATACATGTTTTATGG + Intergenic
1024857866 7:53802287-53802309 CAATCTTAAAATATGTTTCTGGG + Intergenic
1024874232 7:54003579-54003601 CAATCTAAATACAGATTTTTAGG - Intergenic
1026562206 7:71459633-71459655 TTATCCCAAAACATGTTTCTTGG + Intronic
1026798177 7:73379043-73379065 CTATCTAAATATATATATTTAGG + Intergenic
1027515192 7:79133555-79133577 ATATATAAATACATGTTTCTAGG - Intronic
1027797924 7:82716761-82716783 CTCTCTAAATACATGTCTGTAGG - Intergenic
1030728433 7:112954684-112954706 TTTTTTAAATTCATGTTTCTTGG + Intergenic
1030952409 7:115807765-115807787 CCACCAAAATATATGTTTCTGGG - Intergenic
1031356691 7:120796067-120796089 CTTTGTAAATACATTTTTTTTGG - Intronic
1031370973 7:120966073-120966095 ACCTCTAAATACATTTTTCTGGG - Intronic
1032980597 7:137277868-137277890 CTATCTACATATATATTTTTTGG - Intronic
1033011740 7:137630139-137630161 AAATCTAAATGCATGTCTCTTGG + Intronic
1033682607 7:143609912-143609934 CTATTTAAATACTTCTTACTGGG - Intergenic
1033702286 7:143852005-143852027 CTATTTAAATACTTCTTACTGGG + Exonic
1034176972 7:149107635-149107657 CTATATAAATATATCATTCTTGG - Intronic
1035135858 7:156702737-156702759 ATATCAAAAAACATTTTTCTTGG - Intronic
1035462846 7:159055791-159055813 CCATCCAAATACATGTTTGCTGG + Intronic
1036672180 8:10798098-10798120 CCATCCACACACATGTTTCTGGG + Intronic
1037351441 8:17962270-17962292 CTATTTACAAACATGTTTCAAGG - Intronic
1040650048 8:49437555-49437577 AGATATAAATACAAGTTTCTTGG + Intergenic
1040825438 8:51615600-51615622 CAAACTAAATTCTTGTTTCTAGG - Intronic
1042505391 8:69554269-69554291 CTCTATAAATAGATGTTTATAGG - Intronic
1043132420 8:76477861-76477883 AAATTTAAATGCATGTTTCTAGG - Intergenic
1043364092 8:79511309-79511331 ATATCTAAATATATTTTTGTGGG + Intergenic
1044653119 8:94519814-94519836 ATATTTAAATTCATGTATCTAGG + Intronic
1045102258 8:98856847-98856869 CTATGTAATTAAATGTTACTGGG + Intronic
1045628875 8:104091866-104091888 CTATTTAAATAGATATTTCCTGG + Intronic
1045881986 8:107051687-107051709 CAACATAAAAACATGTTTCTTGG + Intergenic
1045943058 8:107761151-107761173 CTATATAAAAATATGTTTGTAGG + Intergenic
1046756251 8:117975517-117975539 CCATCAAAATATATGTTTCTAGG + Intronic
1046815705 8:118581393-118581415 ATATGTAAATCCATGTTTCCAGG - Intronic
1047040205 8:120985476-120985498 TTTTCTAAAAACATGTATCTTGG - Intergenic
1047312638 8:123705521-123705543 CTATTTACATGTATGTTTCTAGG + Intronic
1050252564 9:3760536-3760558 ATAGCCAAATAAATGTTTCTAGG + Intergenic
1050719914 9:8576571-8576593 ATATCTATATACATGTATGTGGG - Intronic
1050847911 9:10246541-10246563 CTATTTTAAAACATGTATCTTGG - Intronic
1051339115 9:16094783-16094805 CTTTCTAATAACCTGTTTCTTGG - Intergenic
1051895819 9:21987958-21987980 CTTTAAAAATACATATTTCTGGG - Intronic
1053041257 9:34874660-34874682 ATATCTAAATGAATGTTTGTTGG - Intergenic
1055657361 9:78464650-78464672 CTAACTTAATAGATGTTTTTTGG + Intergenic
1055968408 9:81887905-81887927 CTATCTCAATCTCTGTTTCTAGG - Intergenic
1056026223 9:82497869-82497891 GTATGTGAATACATTTTTCTAGG + Intergenic
1059140631 9:111849579-111849601 CTTTTTGAATACAGGTTTCTGGG + Intergenic
1185939557 X:4300449-4300471 CTATCTAAGTGCATCTTTGTAGG + Intergenic
1186063273 X:5733883-5733905 TTAATTAAATACATGTTTCATGG + Intergenic
1186117101 X:6316246-6316268 ATATTTAAATACATGATTATGGG + Intergenic
1188311292 X:28619911-28619933 CTATCCAAATGCATTTTGCTTGG + Intronic
1188866421 X:35318617-35318639 CAATCTAAATTCATGGCTCTTGG - Intergenic
1189606866 X:42687576-42687598 CTATTTAAATAGATTTTTCTAGG - Intergenic
1189626629 X:42903953-42903975 ATATCCAAATACATGAGTCTGGG + Intergenic
1191874075 X:65776453-65776475 CTGTTTGAATACTTGTTTCTTGG + Intergenic
1192316698 X:70057819-70057841 CTATCTTAATATATGTTCCATGG - Intergenic
1192570275 X:72198057-72198079 CTTTTTAAATAAATGTTTATTGG + Exonic
1194476358 X:94364474-94364496 TTACCCCAATACATGTTTCTTGG + Intergenic
1194690484 X:96978529-96978551 CTATTTTAATGCATGCTTCTAGG + Intronic
1195255734 X:103088256-103088278 CTTTTTAAATACTTTTTTCTAGG - Intronic
1195606558 X:106811840-106811862 CTATCTTTAGAAATGTTTCTGGG + Intronic
1199134646 X:144235696-144235718 CTATATAAATACATGAGACTGGG - Intergenic
1199150714 X:144482315-144482337 CTTTCTAAATACATGATTATTGG + Intergenic
1200419164 Y:2945151-2945173 CTATTTATAAACATATTTCTAGG - Intronic
1201515113 Y:14811912-14811934 TTATTTAAAAACATGTTTCATGG - Intronic